T-DNA Primer Design
( Powered by GEBD )

The new T-DNA Primer Design Tool is now powered by Genome Express Browser Server (GEBD). The new tool can return the primers faster, and also give the insertion location information, the estimated T-DNA confirmation product size, as well as primer3-like format output. (July 28, 2005)

Important Change: Now the RP is always on the side of the flanking sequence, that is, RP is always on the 3' end of the insertion. Therefore, the PCR reaction should always be set up as LB+RP for HM and LP+RP for WT. (Feb. 04, 2005)

1. Protocol for SALK T-DNA primer design






Note:
    N - Difference of the actual insertion site and the flanking sequence position, usually 0 - 300 bases
    MaxN - Maximum difference of the actual insertion site and the sequence, default 300 bps
    pZone - Regions used to pick up primers, default 100 bps
    Ext5, Ext3 - Regions between the MaxN to pZone, reserved not for picking up primers
    LP, RP - Left, Right genomic primer
    BP - T-DNA border primer LB - the left T-DNA border primer
    BPos - The distance from BP to the insertion site

    LB - Left border primer of the T-DNA insertion:
      >LBb1 of pBIN-pROK2 for SALK lines
      GCGTGGACCGCTTGCTGCAACT
      >LBa1 of pBIN-pROK2 for SALK lines
      TGGTTCACGTAGTGGGCCATCG
      >LB_6313R for SALK lines
      TCAAACAGGATTTTCGCCTGCT

      >LB1 for SAIL lines C/418-451 of pCSA110-pDAP101_T-DNAs
      GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC
      >LB2 for SAIL lines C/390-423 of pCSA110-pDAP101_T-DNAs
      GCTTCCTATTATATCTTCCCAAATTACCAATACA
      >LB3 for SAIL lines C/350-383 of pCSA110-pDAP101_T-DNAs
      TAGCATCTGAATTTCATAACCAATCTCGATACAC

    To download SAIL pCSA110 & pDAP101 T-DNAs.

By using the three primers (LBb1+LP+RP) for SALK lines, users for WT (Wild Type - no insertion) should get a product of about 900-1100 bps ( from LP to RP ), for HM (Homozygous lines - insertions in both chromosomes) will get a band of 410+N bps ( from RP to insertion site 300+N bases, plus 110 bases from LBb1 to the left border of the vector), and for HZ (Heterozygous lines - one of the pair chromosomes with insertion) will get both bands. The product size should be 200 base larger if using LBa1 instead of LBb1. However, the protocol requires the same or similiar TM values for all the LB, LP and RP primers.

You can set up two paired reactions, LP+RP and LB+(LP/RP depending on the insertion direction). You should get a product in the LP+RP reaction for WT or HZ lines or get blank for HM lines, while get a band in the LB+(LP/RP) for HM or HZ lines. (It is for the old isect tool) .
Important Change: Now the RP is always on the side of the flanking sequence, that is, the 3' end of the insert direction. Therefore, the PCR reaction should always be set up as LB+RP for HM and LP+RP for WT.



2. SALK T-DNA verification primer design

The program will pick up LP and RP for you. Its product size is around 900-1100 bps. If you want to confirm whether the design is right, simply cut and paste the LP and RP sequences together (you can cut/paste whole returned primer info line) to the blast textarea on the tdnaexpress2 page, hit "Return" if only one line of text and submit it.

Note: If you could not get primers or high quality primers for a line, it is possible that 1. either your input is "NOT RIGHT". 2. or the genomic region is "NOT GOOD" for picking up primers. However, you can change your settings, especially MAX_N, Ext5, Ext3, and/or pZone to get a return. You could also use the iSect tool to get the genomic sequences around the line and then design primers by yourself or other tools.

If you want to design primers within your sequences, please click here.

    1. PrimerL :
    Primer size - Opt: Min: Max:
    Primer TM - Opt: Min: Max:
    GC Content - Min: Max: Clamp:
    Max N: Ext5: Ext3:
    Primer Zone:  BPos:
    Data Type:  Format:  

    Please paste your list: like
        Salk_000002
        SAIL_155_D07
        GABI_756F01
        FLAG_270B05
        RATM15-1976-1_G
        WiscDsLox289_292P9
        SM_3_19088
        



Now you could paste any T-DNA lines on the T-DNA Express to design their primers (LP/RP). However, 1) please use their own (left) border primer (LB) in PCR. 2) please re-set the parameter Ext5 or MAX_N value according to the distance from their LB to the insertion site. The new Ext5 or MAX_N = 300 + thedistance - 110.



visits since Jan. 30, 2003
© SIGnAL 2000-2004 | Home | About Us | Microarray | cDNA | T-DNA | Database | Links | Contact Us |