This tool allows users submit sequence or multiple sequences in fasta format and return the best pair of primers near the sequence ends.

NOTE: If the product size is NOT suitable, please change the left/right value of the "Primer Region". The default value we use is to get primers at the ends of sequences no matter its length.

If you want to design primers for specific insertion lines, please click here.

PrimerS : iSect primer (S) tool to design primers from user input 
          sequences. For example:

    >YourInput.fa
    CTCGCTGGCCTGTTCAGGTGAATCTTAGTATCGTTTTGTGTCCATGTTGCCTCTACTTCG
    CCTGCTTCTGGTGACTTGAATTCTCTCTTTGTTTTGGGCAGCTTCGGGAACCTTCCACAT
    CCGAAGATGCTGAATTCGCTTCTATTTTGCGGACTCTCAAGGACAGTTTTGATAACGCAT
    TCACTGCTATGATTTCCTTCCAGACGAAGAATTCCGAGCGCATATTCAGCACAGGTATAA