Appendix :
  iSect Tools :      

  • 1. Preferences : Edit your preference to set your own values of the image width, the zoom factor, UTR regions and promoter, to hide or show a set of data, as well as to change display shapes, sizes, colors and track spans instead of default settings. It has less priority than the iView Tool.

  • 2. Search : To open a browser window by querying a gene, a BAC, or data (cDNA, T-DNA) and function. For example: YAL068C or 30338.

  • 3. Locate : To open browser window by positiohing its location (chromosome and position).

  • 4. Fetch : To retrieve all displayed data from a chromosome region. For example: 1234-2345 or W/1234-2345.

  • 5. mText : It is now evolved to accept multiple search for both gene list or cDNA/T-DNA/other list to retrieve related or hited data or genes. For example:
    	please choose type: Gene for gene list or Data for cDNA/T-DNA list.
    
    	YAL068C
    	TM(CAU)Q2
    
    	or
    
    	30338
    	5616
  • 6. iSectR : iSect (R) tool to retrieve sequence from a specific chromosome region. For example : 1234-2345 or 1234-2345,3456-4567.

  • 7. iSectL : iSect (L) tool to retrieve sequences from genome by list of data names or list of genome mapping data. For example:
    	YAL068C
    	30338
    	5616
    
    	or
    
    	query1 chr01 0.0 W/1234-2345
    	search2 chr02 0.0 C/1234-2345,3456-4567
    
  • 8. PrimerL : iSect primer (L) tool to design primers according to a list of data names existed or a list of genome mapping data. For example:
    	YAL068C
    	30338
    	5616
    
    	or
    
    	query1 chr01 0.0 W/1234-2345
    	search2 chr02 0.0 C/1234-2345,3456-4567
    
  • 9. PrimerS : iSect primer (S) tool to design primers from user input sequences. For example:
    	>YourInput.fa
    	CTCGCTGGCCTGTTCAGGTGAATCTTAGTATCGTTTTGTGTCCATGTTGCCTCTACTTCG
    	CCTGCTTCTGGTGACTTGAATTCTCTCTTTGTTTTGGGCAGCTTCGGGAACCTTCCACAT
    	CCGAAGATGCTGAATTCGCTTCTATTTTGCGGACTCTCAAGGACAGTTTTGATAACGCAT
    	TCACTGCTATGATTTCCTTCCAGACGAAGAATTCCGAGCGCATATTCAGCACAGGTATAA