CODE AT3G63540.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr3 TITL AT3G63540.1 CDS ID=AT3G63540.1; Parent=AT3G63540; Name=AT3G63540.1; Note=thylakoid lumenal protein (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein); curator_summary=Conceptual translation of this open reading frame gave the sequence of a 229-residue hypothetical protein that contains the same sequence as the mature A. thaliana chloroplast luminal 19-kDa protein linked to a putative signal sequence.; conf_class=4; computational_description=Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein%3B FUNCTIONS IN: calcium ion binding%3B INVOLVED IN: photosynthesis%3B LOCATED IN: oxygen evolving complex%2C extrinsic to membrane%3B CONTAINS InterPro DOMAIN/s: Photosystem II oxygen evolving complex protein PsbP (InterPro:IPR002683)%2C Mog1/PsbP/DUF1795%2C alpha/beta/alpha sandwich (InterPro:IPR016124)%2C Mog1/PsbP%2C alpha/beta/alpha sandwich (InterPro:IPR016123).; conf_rating=***; Dbxref=PMID:20652368, locus:5019474795; locus_type=protein_coding COOR C/23459372-23459803 HITS RATM11-2432-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-114 LOCN 300-UTR3 COOR C/23458941-23459152 HITS CSHL_ET7048 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/23459007-23459613 HITS CSHL_GT14039 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/23459010-23459613 HITS SALKseq_040217.101 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/23459117-23459117 NOTE KO398249 Salk 20K 3:23459118 CTTTTGTAGGGGCAATTGAAACTCCATTGAATAGTACTCGACACTAGTAAATAATACTAGCAAATTGACGCTTAGACAA HITS RATM11-2432-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 300-UTR3 COOR W/23459145-23459727 HITS CSHL_ET7048 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/23459167-23459521 HITS RAFL16-75-J05 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/23459191-23459603 HITS SALKseq_134752.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/23459205-23459205 NOTE KO347240 Salk 70K 3:23459205 ATAGAGGACACTTTTTACGTATGGATGCCGGGAAAGTTGCAGACAAGCAAATATACAAAAAAAGAACAAATACCCATT HITS SALK_202199 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 1e-72 LOCN 300-UTR3 COOR W/23459209-23459355 NOTE JS805072.1 HITS CSHL_GT7932 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 300-UTR3 COOR W/23459211-23459562 HITS At_oRNA_565 [About Orphan Transcript DB] [AtoRNA Info] TYPE oRNA EST EVAL 99.81 LOCN Exon COOR W/23459227-23459746 HITS CSHL_GT7932 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 300-UTR3 COOR W/23459227-23459562 HITS RAFL09-07-K11 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/23459291-23459723 HITS SALK_134750.45.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Exon COOR W/23459374-23459727 HITS SALK_134752.46.90.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Exon COOR W/23459374-23459727 HITS SGT1641 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL e-176 LOCN Exon COOR C/23459375-23459716 NOTE - HITS SGT1641 [Seq] [about IMA Ds] [Order from ABRC] [Order from NASC] [NCBI] TYPE IMA Ds EVAL e-176 LOCN Exon COOR C/23459375-23459716 HITS SALK_134761.32.65.n [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 6e-73 LOCN Exon COOR W/23459379-23459428,23459573-23459727 HITS SK38628 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 5e-68 LOCN Exon COOR C/23459405-23459538 NOTE CS1014662 HITS SK28984 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 2e-82 LOCN Exon COOR W/23459632-23459789 NOTE CS1009656