CODE AT2G40770.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr2 TITL AT2G40770.2 CDS ID=AT2G40770.2; Parent=AT2G40770; Name=AT2G40770.2; Note=RING-finger%2C DEAD-like helicase%2C PHD and SNF2 domain-containing protein; Dbxref=PMID:11983057, PMID:16132859, PMID:16489130, PMID:18310306, locus:2064786; computational_description=zinc ion binding%3BDNA binding%3Bhelicases%3BATP binding%3Bnucleic acid binding%3B FUNCTIONS IN: helicase activity%2C DNA binding%2C zinc ion binding%2C nucleic acid binding%2C ATP binding%3B EXPRESSED IN: 21 plant structures%3B EXPRESSED DURING: 11 growth stages%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C RING-type (InterPro:IPR001841)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C PHD-type (InterPro:IPR001965)%2C SNF2-related (InterPro:IPR000330)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Tetratricopeptide repeat-containing (InterPro:IPR013026)%3B BEST Arabidopsis thaliana protein match is: SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-related (TAIR:AT1G61140.1)%3B Has 20880 Blast hits to 12947 proteins in 1504 species: Archae - 88%3B Bacteria - 5732%3B Metazoa - 4955%3B Fungi - 5171%3B Plants - 2134%3B Viruses - 115%3B Other Eukaryotes - 2685 (source: NCBI BLink).; locus_type=protein_coding COOR C/17013535-17013825,17013928-17014183,17014277-17014428,17014500-17014693,17014833-17015034,17015339-17015581,17015687-17015803,17016020-17016226,17016317-17016533,17016864-17017030,17017222-17017761,17017828-17017988,17018127-17018358,17018433-17018688,17018954-17019154,17019297-17019771,17019988-17020049,17020210-17020416,17020501-17021315 HITS SALKseq_037054.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/17013253-17013253 NOTE KO341167 Salk 10K 2:17013157 TTTCTTCAATGTAGTTGACTGATTTGTCTTCTCAAATGTTATAACAAACAAGAAAAGAGTACAAATTGACGCTTAGACA HITS SAIL_533_A07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR3 COOR W/17013344-17013670 HITS SAIL_533_A07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR3 COOR W/17013344-17014157 HITS SALKseq_089221.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/17013450-17013450 NOTE KO438799 Salk 80K 2:17013447 AAAGGTTGCAGAGAGATTGGTTCCAGCCAAATGTTTGTTGGAGCGTCTTGTTGTATGCACATAAGATGGTGAAGAGAG HITS SAILseq_620_E08.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/17013733-17013733 NOTE KO335085 SAIL 30K 2:17013768 CTCTCTCCTGGGTTTTGTTCCATCTCTGCTGTTTCTGCTGTTGGTGAAGCAAATAGAGATTCAAGATCTTTTAGTGTCAAGAACTGTTGATCTGT HITS SAIL_620_E08 SAIL T-DNA Homozygous Knockout Line for At2g40770
[Seq] [SAIL HM Collection by Salk] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM EVAL 4e-26 LOCN Exon COOR W/17013746-17013834 NOTE At2g40770 HITS SK39896 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 4e-67 LOCN Intron COOR W/17013829-17014169 NOTE CS1015083 HITS SAIL_11_B06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN Exon COOR W/17014157-17014906 HITS SALKseq_092176.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/17014180-17014180 NOTE KO432633 Salk 10K 2:17014140 TTGTCTTTTGGGTTTCTTTCTCAGATCCCTTGAATTTGCTAATGGCTGTCTGTGATAAACAAATTGACGCTTAGACAAC HITS SALKseq_68914.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR W/17014233-17014233 NOTE KO448291 Salk 70K 2:17014232 GAAAGGGGGCAGGTAATGTAGTGAGAATTTTAATGGGGAGTCTGTTAAAAGTGGCAAATTGACGCTTAGACAACTTAAT HITS SK30755 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 4e-48 LOCN Exon COOR C/17014718-17015025 NOTE CS1010593 HITS GABI_630A11 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-16 LOCN Exon COOR C/17015420-17015469 NOTE - - HITS SALK_102485.54.80.x SALK T-DNA Homozygous Knockout Line for ATx by community
[Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM (c) EVAL 0.0 LOCN Exon COOR W/17015581-17015974 NOTE ATx CS24730 HITS SALK_102485.54.80.x SALK T-DNA Homozygous Knockout Line for At2g40770 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Exon COOR W/17015581-17015974 NOTE At2g40770 HITS SALK_143027.33.60.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-38 LOCN Intron COOR W/17015827-17015966 HITS SAIL_118_E01 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-144 LOCN Intron COOR W/17015838-17016336 HITS SALK_106838.51.50.x SALK T-DNA Homozygous Knockout Line for At2g40770 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-104 LOCN Intron COOR W/17015954-17016143 NOTE At2g40770 HITS SALK_021352.56.00.x SALK T-DNA Homozygous Knockout Line for At2g40770 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Intron COOR C/17015966-17016312 NOTE At2g40770 HITS SAIL_10_D12 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 3e-29 LOCN Intron COOR W/17016009-17016087,17016099-17016276 HITS SAIL_279_F12 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-37 LOCN Exon COOR W/17016104-17016319 HITS GABI_912A09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-83 LOCN Exon COOR W/17016343-17016570 NOTE - - HITS GABIseq_075A03.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/17016531-17016531 NOTE KG780963 GABI 10K 2:17016531 TGATCAATTTCTAGAATCCTATCTATCACTTTCTTTCTAGATCTCTCCAGCATATCCATACACGTCTGCAGATGAAGTTTCATGCCATGTATAGTTCTAA HITS SALKseq_092176.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/17016930-17016930 NOTE KO435941 Salk 10K 2:17016929 GCCCTGCAACTTACTGAACAGAATAAAGACTTCTCTAGCGAGTTGACGCTTAGACAACTTAATCACTGAAGATCGGAAG HITS SALK_092176.52.75.x SALK T-DNA Homozygous Knockout Line for At2g40770 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-175 LOCN Exon COOR W/17016935-17017244 NOTE At2g40770 HITS SALK_118316.51.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-90 LOCN Intron COOR W/17017077-17017244 HITS SALKseq_059453.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/17017168-17017168 NOTE KO402514 Salk 40K 2:17017109 CTTGTAACTTAATTTAAACGGATTATATTTACACTTAGGCTAAGGGTACAAATAAGCGGACAAATTGACGCTTAGACAA HITS SALK_059453.47.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-26 LOCN Intron COOR W/17017186-17017244 HITS SALK_059453.47.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-20 LOCN Intron COOR W/17017196-17017244 HITS SK29592 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 2e-83 LOCN Exon COOR W/17018438-17018593 NOTE CS1010020 HITS SALKseq_030946.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/17018538-17018538 NOTE KO384410 Salk 10K 2:17018500 ATCGAAAGGATTTGCTTTAAGAAACTTCAATAGTCCAAATAAGTCATCAAGTTTGCGTTGTATATATTGTGGTGTAAAC HITS GABI_120B01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN Exon COOR C/17019851-17020315 NOTE - - HITS SALK_011033.30.30.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-78 LOCN Intron COOR C/17020007-17020178 HITS SALK_064548.51.55.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Intron COOR C/17020100-17020481 HITS SALK_025888.34.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-86 LOCN Exon COOR W/17020751-17020971 HITS SALKseq_078934.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/17020958-17020958 NOTE KO430328 Salk 70K 2:17020900 CATCAGACACCTTATTATCAACCAATTCCAAAGTTATATCACTCGAAGACAAAACCGGCCAACAAATTGACGCTTAGAC HITS SALK_075262.51.55.x SALK T-DNA Homozygous Knockout Line for At2g40780 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-69 LOCN 300-UTR5 COOR C/17021347-17021487 NOTE At2g40780 HITS SALK_128770.47.40.x SALK T-DNA Homozygous Knockout Line for At2g40770 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 1e-73 LOCN 300-UTR5 COOR C/17021348-17021487 NOTE At2g40770 HITS SALK_014987.54.00.x SALK T-DNA Homozygous Knockout Line for At2g40780 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 7e-38 LOCN 300-UTR5 COOR C/17021535-17021614 NOTE At2g40780 HITS SALK_014987.54.50.x SALK T-DNA Homozygous Knockout Line for At2g40780 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 1e-38 LOCN 300-UTR5 COOR C/17021535-17021614 NOTE At2g40780 HITS SALK_029569.54.25.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-38 LOCN 300-UTR5 COOR C/17021535-17021614 HITS SALKseq_029569.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/17021614-17021614 NOTE KO340810 Salk 10K 2:17021401 GAATCGACGGAGACTATGGAGGAGTGGAATTTCAAGCGCCGGAGAAGATTAATAGCAAGCGCAGGATATATTGTGGTGC HITS DQ446615 [About TIGR ORFs] [GenBank] TYPE TIGR ORFs EVAL 99.42 LOCN 1000-Promotor COOR W/17022211-17022226,17022337-17022463,17022550-17022746 HITS DQ653053 [About TIGR ORFs] [GenBank] TYPE TIGR ORFs EVAL 99.12 LOCN 1000-Promotor COOR W/17022211-17022226,17022337-17022463,17022550-17022745