CODE AT2G40711.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr2 TITL AT2G40711.1 CDS ID=AT2G40711.1; Parent=AT2G40711; Name=AT2G40711.1; Note=hypothetical protein; conf_class=1; computational_description=unknown protein%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:17395691, locus:4515102973; locus_type=protein_coding COOR C/16981927-16982244 HITS DQ487516 [About TIGR ORFs] [GenBank] TYPE TIGR ORFs EVAL 99.37 LOCN Exon COOR C/16981929-16982244 HITS DQ652663 [About TIGR ORFs] [GenBank] TYPE TIGR ORFs EVAL 99.06 LOCN Exon COOR C/16981930-16982244 HITS SALKseq_056439.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/16981944-16981944 NOTE KO392316 Salk 30K 2:16981861 GTAATTTTTTGGCTTCATATTCTTAATTCTTTTTCCCTTTACAGCTCTAGCGCCATTTATATTGTGGTGTAAACAAAT HITS SALK_208191 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 4e-115 LOCN Exon COOR W/16981963-16982186 NOTE JY126559.1 HITS SALKseq_048213.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/16982225-16982225 NOTE KO388597 Salk 30K 2:16982112 CATCATAGACAGCCCTTCTCCATATTACCTTACAAATTGACGCTTAGACAACTTAATTCTGCTAGATTGGAAGAGCGG HITS SALK_048213.49.70.x SALK T-DNA Homozygous Knockout Line for AT3G41979 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 4e-54 LOCN Exon COOR W/16982234-16982339 NOTE AT3G41979 HITS SALK_033281.29.99.f [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 6e-70 LOCN 300-UTR5 COOR C/16982336-16982469 HITS SALK_033281.50.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-70 LOCN 300-UTR5 COOR C/16982336-16982469 HITS WiscDsLoxHs132_12C [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR C/16982756-16983212 HITS SALK_089970.34.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/16982846-16983255 HITS FLAG_465H06 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 1000-Promotor COOR W/16983003-16983732 HITS SALK_014972.23.55.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-67 LOCN 1000-Promotor COOR W/16983020-16983332 HITS SALK_014972.29.99.f [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-67 LOCN 1000-Promotor COOR W/16983020-16983332 HITS GABI_348H05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-113 LOCN 1000-Promotor COOR W/16983219-16983424 NOTE - - HITS SALKseq_093820.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/16983238-16983238 NOTE KO439402 Salk 80K 2:16983239 TTCTTATTTACGAAATTTTGCTCAACAAGATGCGAAAGAGTAAGAGACGAATAAATTGACGCTTAGACAACTTAATTC