CODE AT2G40700.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr2 TITL AT2G40700.1 CDS ID=AT2G40700.1; Parent=AT2G40700; Name=AT2G40700.1; Note=P-loop containing nucleoside triphosphate hydrolases superfamily protein; conf_class=2; computational_description=P-loop containing nucleoside triphosphate hydrolases superfamily protein%3B FUNCTIONS IN: helicase activity%2C ATP binding%2C ATP-dependent helicase activity%2C nucleic acid binding%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA helicase%2C DEAD-box type%2C Q motif (InterPro:IPR014014)%2C DNA/RNA helicase%2C DEAD/DEAH box type%2C N-terminal (InterPro:IPR011545)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%3B BEST Arabidopsis thaliana protein match is: DEA(D/H)-box RNA helicase family protein (TAIR:AT5G65900.1)%3B Has 40440 Blast hits to 37904 proteins in 2977 species: Archae - 739%3B Bacteria - 19708%3B Metazoa - 6217%3B Fungi - 4486%3B Plants - 2481%3B Viruses - 5%3B Other Eukaryotes - 6804 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15356332, PMID:20687615, locus:2064844; locus_type=protein_coding COOR W/16976780-16976918,16977008-16977080,16977182-16977291,16977376-16977519,16977581-16977689,16977772-16978124,16978200-16978273,16978367-16978674,16978774-16979020,16979117-16979392 HITS RAFL07-09-L18 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-113 LOCN 1000-Promotor COOR W/16975795-16975888,16975982-16976131,16976224-16976439 HITS GABI_160E12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-11 LOCN 1000-Promotor COOR C/16976075-16976146 NOTE - - HITS GABI_296A04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-51 LOCN 300-UTR5 COOR W/16976663-16976836 NOTE - - HITS SALKseq_083995.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/16977187-16977187 NOTE KO431205 Salk 80K 2:16977100 TTTGTAGTTTGGTTTGTTTTCAGTTAACTTGAGATATATAAATGTATAGACTTGTGGTGTAAACAAATTGACGCTTAG HITS FLAG_135D12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 3e-93 LOCN Exon COOR C/16977648-16977827 HITS SALKseq_076414.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/16977696-16977696 NOTE KO366560 Salk 70K 2:16977602 ACACAGCTTCATTTGTGCACAAAAATCTGCGTTGGGTCATCTTTGATGAAGCTGATAGGTATAAACAAATTGACGCTTA HITS SALK_076414.45.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-122 LOCN Exon COOR W/16977845-16978179 HITS SAIL_789_F01 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-06 LOCN Exon COOR W/16978090-16978169 HITS GABI_814E05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN Exon COOR C/16978126-16978541 NOTE - - HITS AJ010468 [GenBank] TYPE Community cDNA EVAL 98.16 LOCN Exon COOR W/16978206-16978273,16978367-16978674,16978774-16979020,16979118-16979559 HITS GABI_783G01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-129 LOCN Exon COOR C/16979022-16979254 NOTE - - HITS SALK_027066.41.90.x SALK T-DNA Homozygous Knockout Line for At2g40700 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-123 LOCN 300-UTR3 COOR C/16979214-16979464 NOTE At2g40700 HITS SALK_013332.52.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/16979214-16979624 HITS SAILseq_422_B06.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/16979366-16979366 NOTE KO325689 SAIL 30K 2:16979420 TTACGCCACGGTTTATGGTGGAGAAACCGATTTCATCAAGTTTTTTGTGTACTTCTATTGCCCTTAACAAGTTATATAGTGAGAATAAATTAAGA HITS SALKseq_109467.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/16979683-16979683 NOTE KG789803 Salk 20K 2:16979632 TTTTTTATGAAAATTCGGTTTAGAATCTATGAAAATCTAGATTTGCGAATTGCCGCTTAGGTGTAAACAAATTGACGCT