CODE AT2G09180.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr2 TITL AT2G09180.1 lnc_RNA ID=AT2G09180.1; Parent=AT2G09180; Name=AT2G09180.1; locus_type=long_noncoding_rna COOR C/17006644-17006918 HITS SALKseq_057997.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/17006567-17006567 NOTE KO399090 Salk 40K 2:17006505 CAAACGTAGTCTTCACGAGATATATTTGGACTACATCCTGAATAACACATTGCGTAAACAAATTGACGCTTAGACAAC HITS GABI_378H01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 6e-79 LOCN 1000-Promotor COOR C/17007343-17007498 NOTE - - HITS GABI_269H06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-39 LOCN 1000-Promotor COOR W/17007359-17007447 NOTE - - HITS GABI_426B04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 5e-38 LOCN 1000-Promotor COOR W/17007364-17007442 NOTE - - HITS SALK_062018.53.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-177 LOCN 1000-Promotor COOR C/17007416-17007729 HITS SALK_062308.53.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-177 LOCN 1000-Promotor COOR C/17007416-17007729 HITS GABI_497G10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-90 LOCN 1000-Promotor COOR C/17007444-17007619,17007653-17007707 NOTE - - HITS GABI_757B10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 5e-13 LOCN 1000-Promotor COOR C/17007445-17007485 NOTE - - HITS GABI_497G10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-94 LOCN 1000-Promotor COOR C/17007449-17007626 NOTE - - HITS SALK_038367.35.25.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-174 LOCN 1000-Promotor COOR C/17007456-17007824 HITS SALKseq_084226.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/17007664-17007664 NOTE KO427935 Salk 80K 2:17007666 AATTGAGGATGAAGCAAACCAATCAATGATTATTAAAACTTGATTGTCCTTGTTGCTAACTGCTGAATAATGATTCTT HITS SALKseq_084226.001 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/17007675-17007675 NOTE KO431251 Salk 80K 2:17007674 TAAAAATCCAATTTTATAATCAACAAGGTAAAATTCCAACAAATTTTCATTTTCTTGACAAATTGACGCTTAGACAAC HITS SALK_084226.26.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-67 LOCN 1000-Promotor COOR W/17007688-17007921 HITS GABI_918B06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-86 LOCN 1000-Promotor COOR W/17007690-17007870 NOTE - - HITS GABI_528C02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-21 LOCN 1000-Promotor COOR W/17007692-17007763 NOTE - - HITS GABI_632D09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-14 LOCN 1000-Promotor COOR W/17007719-17007761 NOTE - - HITS SALK_101545.54.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-77 LOCN 1000-Promotor COOR W/17007761-17007921 HITS SALKseq_062683.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/17007764-17007764 NOTE KO359200 Salk 40K 2:17007762 AACTTCCAACGATTTAATGCTTTGGAATTGGAGGCATTTAATCTTAAGTTTTGAGGATTCGTGAAATAAGGGTGTGTTT HITS SALKseq_062018.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/17007779-17007779 NOTE KO382597 Salk 40K 2:17007750 CGAATAAACATCATACTTTACCTAGCAAACACACCCTTATTTAATCTTAAGTTTTAAGTGTAAACAAATTGACGCTTA HITS SALKseq_047692.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/17007781-17007781 NOTE KO375182 Salk 30K 2:17007782 ACCTTGTTGATTATAAAATTGGATTTTTACGTTTCGAATAAACATCATACTTTACCTAGCAAACACACCCTTATTTCAGGATATATTGTGGTGTA HITS SALK_062683.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-68 LOCN 1000-Promotor COOR W/17007791-17007920 HITS SALK_062685.51.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 9e-63 LOCN 1000-Promotor COOR W/17007800-17007920