CODE AT1TE65690 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [NCBI] [KEGG] [Protein Interaction] [AtGene Express] [AtGDB View] 
[e-FP Browser] [AthaMap] [Phosphat] [Methylome] [UToronto BAR Expression Angler] [Araport ] [TAIR ]
Genome Browsers: [1001 Genomes] [1001 Epigenomes] [ABA TF Network] TYPE Gene CHRO chr1 TITL AT1TE65690 transposable_element AT1TE65690 ID=AT1TE65690; Name=AT1TE65690; Alias=ATREP3 COOR W/19870091-19871188 HITS SAIL_23_H02 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-145 LOCN 1000-Promotor COOR C/19869007-19869339 HITS SALKseq_074058.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/19869351-19869351 NOTE KO363147 Salk 60K 1:19869352 AACACGATTGCTTTTGTGTCTTAACTCTTAACATTGAAGCAACTTTTTATGATTTAAAGATAATGAAAGAGACATACAA HITS BX817988 [GenBank] [Order] TYPE GSLT cDNA EVAL e-133 LOCN Exon COOR C/19869560-19869806,19869904-19870095 HITS SALK_096389.51.70.x SALK T-DNA Homozygous Knockout Line for At1g53285 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-122 LOCN 300-UTR5 COOR C/19869723-19869947 NOTE At1g53285 HITS FLAG_401A08 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 300-UTR3 COOR C/19870757-19871357 HITS SALKseq_068132.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/19871036-19871036 NOTE KO349501 Salk 50K 1:19871029 TCTCAATTTCTCATCAATGCTATATAAAGTTGTTTGGATTCAAACGTAGATTAGTTAATATTGTGGTGTAAACAAATT HITS SALK_068132.19.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-24 LOCN Exon COOR W/19871038-19871097 HITS SALK_103740.49.25.x SALK T-DNA Homozygous Knockout Line for At1g53290 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-49 LOCN 300-UTR3 COOR C/19871094-19871191 NOTE At1g53290 HITS SALK_015338.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-144 LOCN 300-UTR3 COOR C/19871094-19871351 HITS SALK_124084.51.25.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-35 LOCN Exon COOR C/19871094-19871167 HITS GABI_270D09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-177 LOCN Exon COOR W/19871116-19871436 NOTE - - HITS SALKseq_124084.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/19871179-19871179 NOTE KO393576 Salk 60K 1:19871093 ATTTAGTCAATTTAACGTTGCCTAATTTCTTTACAATTACAACTAAAAGTTCAAAAAAATAATTGTGGTGTAAACAAAT HITS GABI_271E10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-101 LOCN 300-UTR3 COOR W/19871226-19871436 NOTE - - HITS BX818271 [GenBank] [Order] TYPE GSLT cDNA EVAL e-171 LOCN 300-UTR3 COOR W/19871331-19871710,19872071-19872172,19872372-19872399,19872497-19872598,19872714-19872825,19872911-19873053,19873160-19873321 HITS R15299 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 100.00 LOCN 300-UTR3 COOR W/19871350-19871708,19872070-19872222,19872320-19872402,19872500-19872599,19872715-19872828,19872914-19873056,19873163-19873382 NOTE AY128376 HITS U15299 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN 300-UTR3 COOR W/19871353-19871708,19872070-19872222,19872320-19872402,19872500-19872599,19872715-19872828,19872914-19873056,19873163-19873251 NOTE BT008831 HITS G15299 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN 300-UTR3 COOR W/19871353-19871708,19872070-19872222,19872320-19872402,19872500-19872599,19872715-19872828,19872914-19873056,19873163-19873251 NOTE U15299 BT008831 pENTR_Sfi HITS BX818399 [GenBank] [Order] TYPE GSLT cDNA EVAL e-179 LOCN 300-UTR3 COOR W/19871392-19871708,19872070-19872203,19872320-19872399,19872497-19872598,19872714-19872825,19872911-19873058,19873165-19873316