CODE AT1TE61060 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE61060 transposable_element ID=AT1TE61060; Name=AT1TE61060; Alias=ATREP4 COOR W/18421417-18421503 HITS SALK_070627.55.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-89 LOCN 1000-Promotor COOR C/18420530-18420695 HITS SALKseq_086103.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/18421122-18421122 NOTE KO434912 Salk 80K 1:18421121 CAATATCCTACTCGATTATTCGGGTGAAAATAAAGCATGTTTAGAAGTTTATGCCACAATATATTGTGGTGTAAACAA