CODE AT1TE61040 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE61040 transposable_element ID=AT1TE61040; Name=AT1TE61040; Alias=HELITRON2 COOR W/18415297-18415336 HITS SALK_088370.55.00.x SALK T-DNA Homozygous Knockout Line for At1g49750 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-118 LOCN 1000-Promotor COOR C/18414342-18414555 NOTE At1g49750 HITS SALK_088378.41.45.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-40 LOCN 1000-Promotor COOR C/18414342-18414453 HITS SALK_150037.16.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-45 LOCN 300-UTR3 COOR C/18415146-18415553 HITS SALK_106238.28.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-52 LOCN 300-UTR5 COOR C/18415148-18415287 HITS SALKseq_138433.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/18415157-18415157 NOTE KO370829 Salk 60K 1:18415069 TAGCCATAAGAATCATTCAAGATGAGTATTTTAATTATTAATGTGTTTAATGCAAATTGACGCTTAGACAACTTAATCA HITS SALKseq_106238.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/18415339-18415339 NOTE KG788131 Salk 100K 1:18415316 TAAAGTTTTATTGTTACTAATAAAAAATAACAGTCACAGCTTCTACAACTTTGTTTTACCAATCTGATTTTAACAAATTGACGCTTAGACAACTTAATAA HITS GABI_211G06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-104 LOCN 300-UTR3 COOR W/18415409-18415627 NOTE - - HITS SALKseq_75736.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/18415556-18415556 NOTE KO448589 Salk 80K 1:18415486 AAGAGATGATATTGTTATTACACATTTCACGCTGAAGAGATACTAAAAACAGGATATATTGTGGTGTAAACAAATTGA HITS SALKseq_079988.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/18415563-18415563 NOTE KO423829 Salk 70K 1:18415564 AGATGATATTTTTATTACACATTTCACGCTGAAGAGATACTAAAAACAGTTAGAAATTATGGTGGTGTAAACAAATTGA