CODE AT1TE00225 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE00225 transposable_element ID=AT1TE00225; Name=AT1TE00225; Alias=HELITRONY1D COOR C/78288-78785 HITS GABI_089D01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-132 LOCN 300-UTR5 COOR C/78627-78891 NOTE - CS408485 HITS SALKseq_084456.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/78652-78652 NOTE KO424668 Salk 80K 1:78649 ATATTGAGTTGTCTTTGACAATATTTTAAACTAGTTGTAAATCACAGAGATAAACACCATAACAAATTGACGCTTAGA HITS SALK_003854.48.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-11 LOCN Exon COOR W/78696-78757 HITS SALKseq_066022.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/78809-78809 NOTE KO359405 Salk 50K 1:78810 TGCATATTTAGTTTAAATACAAATAAACGAAACAAAAAGCAAAAAGCATAGACGGATCCGTAAATCTACT HITS GABI_089D01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-143 LOCN 300-UTR5 COOR W/78969-79232 NOTE - CS408485 HITS GABI_089E07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-127 LOCN 300-UTR5 COOR W/78969-79233 NOTE - - HITS GABI_089F03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-145 LOCN 300-UTR5 COOR W/78969-79232 NOTE - - HITS GABI_521A10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-131 LOCN 1000-Promotor COOR C/79230-79513 NOTE - - HITS SALK_005730.24.95.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-42 LOCN 1000-Promotor COOR C/79400-79517 HITS SALK_006073.42.15.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-35 LOCN 1000-Promotor COOR C/79402-79475 HITS WiscDsLox500B03 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR W/79632-80163 HITS GABIseq_178A04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/79774-79774 NOTE KG782393 GABI 10K 1:79850 CATAATTAAAGATGAAGACTCGAATGTATATGTGTATGCGTGGTTTCATATGTATTTATGTTTTTGGCAGCCTGCATGTGAATATTCAATTGTAAATGGC