CODE AT1TE00220 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE00220 transposable_element ID=AT1TE00220; Name=AT1TE00220; Alias=TA11 COOR W/76844-77500 HITS GABI_102G11 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN 1000-Promotor COOR W/75931-76405 NOTE at1g01180 CS409779 HITS GT_5_100759 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 2e-72 LOCN 1000-Promotor COOR C/75983-76119 NOTE CS164573 HITS GABIseq_535A12.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/76059-76059 NOTE KG787536 GABI 10K 1:76032 AAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCAAACCTAAGACGATCGTCGAAGTCAGGATATATTCAATTGTA HITS GABI_102H12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-123 LOCN 1000-Promotor COOR W/76181-76569 NOTE - - HITS RAFL14-83-E11 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN 300-UTR5 COOR W/76210-76636 HITS Wiscseq_DsLox242H01.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/76563-76563 NOTE KG796357 Wisc 10K 1:76541 CTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAACCGATGGTCAACATTGGGTTATTGATTCGGTCAAAGTAACCTGATTCCCTTAATAACACATTGCGG HITS GABI_363E08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-141 LOCN 300-UTR5 COOR W/76584-76896 NOTE - - HITS WiscDsLox242H01 Wisc T-DNA Homozygous Knockout Line for At1g01180 by Salk
[Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc T-DNA HM EVAL 0.0 LOCN 300-UTR5 COOR W/76610-77058 NOTE At1g01180 HITS Wiscseq_DsLoxHs051_12F.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/76713-76713 NOTE KG812593 Wisc 20K 1:76713 ATATTTTTTTTCCATCTTTTGAAAATTAATGGATTTGAGGTTTTTGATTGTGTAATGAGAAAAAATATTTGATTGATCAG HITS GABI_100D05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-152 LOCN Exon COOR C/76773-77047 NOTE - - HITS GABI_177C02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-37 LOCN Exon COOR W/77000-77077 NOTE - - HITS SK34859 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 7e-54 LOCN Exon COOR C/77055-77161,77073-77159 NOTE CS1012768 HITS SAIL_528_A03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR3 COOR C/77055-77519 HITS SALK_064577.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Exon COOR C/77109-77456 HITS SAILseq_528_A03.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/77465-77465 NOTE KO330767 SAIL 30K 1:77463 CCGCCAATCGTATGTAGCAACCGGGTTTCCTTTTTGGCTGAAACATCTTTTTGAGAAAGAAAGAAGTATTGCTTAGTGTAATACTCATTGTGGTT HITS SALKseq_46135.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/77482-77482 NOTE KO451947 Salk 50K 1:77482 TTTTTTATTTTTTTTTCATTGAAAGATATATTTTATATTCAAGATTGTAACCAAATATACAAAAAGCCTTATTCAAGAT HITS Wiscseq_DsLox384A3.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/77529-77529 NOTE KG802156 Wisc 10K 1:77542 AAAGAAGTATTGCTTAGTGAAATACTCATTGTGGTTGATCTAGAATGATTGTCCTTGATCCTAACTTTTTGTATATTTGGTTACAGTCTTGCATATAAAA HITS SALKseq_064578.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/77534-77534 NOTE KO366008 Salk 50K 1:77535 CTAGAATGATTGTCCTTGATCCTAACTTTTTGTATATTTGGTTACAGTCTTGAATATAAAATATATTGTGGTGTAAACA HITS GABI_171B10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-99 LOCN 300-UTR3 COOR C/77545-77731 NOTE - - HITS SALKseq_082447.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/77547-77547 NOTE KO424288 Salk 80K 1:77543 TCTTACAATCTCGTATTAGGCCCAATTATGTTTAATTGTAATTCTGCTTTGCTTAGAGGTTGTGCTTTTTTTTTTTTT HITS SAIL_63_C09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 6e-71 LOCN 300-UTR3 COOR C/77606-77764 HITS SALK_005299.53.05.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-35 LOCN 300-UTR3 COOR W/77617-77692 HITS SALK_005300.54.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-36 LOCN 300-UTR3 COOR W/77617-77692 HITS SALK_005301.32.25.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-13 LOCN 300-UTR3 COOR W/77617-77670 HITS SALK_005305.53.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-36 LOCN 300-UTR3 COOR W/77617-77692 HITS SALK_005317.19.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-17 LOCN 300-UTR3 COOR W/77621-77692 HITS SALK_005317.29.99.f [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-16 LOCN 300-UTR3 COOR W/77621-77692