CODE AT1TE00150 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE00150 transposable_element ID=AT1TE00150; Name=AT1TE00150; Alias=SIMPLEHAT1 COOR W/55676-55873,55874-56576 HITS GABI_720H05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN 1000-Promotor COOR C/54582-55089 NOTE - - HITS SALK_094042.30.45.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-162 LOCN 1000-Promotor COOR C/54822-55253 HITS SALK_094042.30.45.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-159 LOCN 1000-Promotor COOR C/54831-55253 HITS SALK_040104.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR C/54859-55280 HITS SALK_040106.46.35.n [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-103 LOCN 1000-Promotor COOR C/54862-55223 HITS SALKseq_055990.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/54879-54879 NOTE KO412346 Salk 30K 1:54821 CGCCTTTTGCAGGATTGAAAAATACTAAAAGATAAAAAGATTTGAATCTTAGACAGGATATATTGTGGTGTAAACAAAT HITS GABI_215D10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-139 LOCN 1000-Promotor COOR W/55092-55424 NOTE - - HITS SALK_127629.22.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-92 LOCN 300-UTR5 COOR C/55119-55401 HITS SALK_066345.31.25.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 7e-72 LOCN 1000-Promotor COOR C/55138-55278 HITS SALKseq_64917.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/55270-55270 NOTE KO448062 Salk 70K 1:55276 AAACACAAAGTTTGAGATCCTTTAAGAAAAAAACAGAAAATCTGCTAACAAATCAACAAAACTTGAGCAAAGAAAATAA HITS SALKseq_040104.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/55282-55282 NOTE KO348055 Salk 20K 1:55283 AATCTGCTAACAAATCAACAAAACTTGAGCAAAGAAAATAAAAGAATAAAAATATATTGTGGTGTAAACAAATTGACGC HITS SALKseq_066345.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/55360-55360 NOTE KO379516 Salk 50K 1:55287 AAGGGAGAAACTCCAAAACGGCATGTAGTTAGCTGGGGGTTGCGCGTTCTGGAACAAATTGACGCTTAGACAACTTAA HITS GABI_761C08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-59 LOCN 300-UTR5 COOR C/55423-55541 NOTE - - HITS WiscDsLoxHs168_08D [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 9e-33 LOCN 300-UTR5 COOR C/55448-55521 HITS SALKseq_117960.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/55548-55548 NOTE KG794155 Salk 110K 1:55528 GAAGGGTGGCGTCATATCATGTGACCCCAGCACACCGTAATGGTCTTCTCATACGGCCCAGTGGGCATTAAAGAGATTGCGGACAAATTGACGCTTAGAC HITS GABI_327C06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-20 LOCN 300-UTR5 COOR W/55558-55655 NOTE - - HITS SALKseq_071578.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/55758-55758 NOTE KO415895 Salk 50K 1:55758 CCCATAACACAATGAGGTAAACCCATATGGGTTTTATTTATTTGGGTACCCAGCTCATTTTAAACCTGTGTTTTTTTT HITS SALKseq_122242.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/55764-55764 NOTE KO416054 Salk 60K 1:55764 TAATGATGGGTTAAAACTCACTGGGTACTCAAAACCCACATAAAATTTTAAGCTCATAGATCTACTTTTTCTGGAAAA HITS SALKseq_059910.4 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/55877-55877 NOTE KO355690 Salk 40K 1:55974 TAAAACCCATATGGGTTTACCTCATTGGGTTATGGGTACCCACGGGTTTTTTTTAAGTCCTTTTTTCAGTTGATCAAA HITS SALKseq_138822.4 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/55974-55974 NOTE KO416587 Salk 10K 1:55974 CATTTTCTTGTAAAAAAAAATTTCACATTTTTTCCCCTAAACCGCGATTTAACAGTTTACCGCCAAAAAAAACATTCAACATTTTCCCGCCAAAA HITS SALKseq_138822.5 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/56235-56235 NOTE KO416588 Salk 10K 1:56235 GTATTACATATATATTTGATGGGAAAAAGGTTGAATTGCGTTTTTGGCGGGAAAATGTTAAATTGCGTTTTTGGCGGG HITS SALKseq_089693.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/56782-56782 NOTE KO422330 Salk 80K 1:56707 GGTTATAGTTATACGAGTTGTTGACCGAATTTATGGTTCAAGACTTTCAAGAACTAAGAGAAATTGACGCTTAGACAA