CODE AT1TE00030 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE00030 transposable_element ID=AT1TE00030; Name=AT1TE00030; Alias=ATHATN7 COOR C/18331-18642 HITS RATM11-5037-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR C/17947-18151,18183-18526 HITS SALKseq_129412.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/18119-18119 NOTE KO416351 Salk 20K 1:18119 AACTAAAATATAAGCCTACCTGCTGTATAATGCAAGTTAAAATTATAAATAAGCAGATTACCATCACGATGGATGTACC HITS RATM11-5037-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR W/18519-18936 HITS SALK_149800.19.85.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-48 LOCN 1000-Promotor COOR C/18963-19091 HITS SALK_149800.19.85.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 7e-44 LOCN 1000-Promotor COOR C/18975-19091 HITS SAILseq_588_C07.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/19046-19046 NOTE KO325916 SAIL 30K 1:19085 AAAACCAGAGTGTGTATACGAATAAAAGTTGTGTATCACTGAACACACCAAATTTATATCTAGTCAACAATAGCATATATTGTGGTGTAATCAAT HITS SALKseq_076097.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/19083-19083 NOTE KO343133 Salk 70K 1:19086 GATTCTGATATTTCCTTCAAAAACCAGAGTGTGTATACGAATAAAAGTTGTGTACACATTGCGGTGTAAACAAATTGAC HITS SALK_076195.52.70.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-68 LOCN 1000-Promotor COOR W/19087-19256 HITS SALK_076097.29.15.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-44 LOCN 1000-Promotor COOR W/19093-19250