CODE AT1TE00010 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1TE00010 transposable_element ID=AT1TE00010; Name=AT1TE00010; Alias=ATCOPIA24 COOR W/11897-11976 HITS SM_3_36088 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 2e-13 LOCN 1000-Promotor COOR C/11391-11428 NOTE CS122799 HITS RATM11-4609-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 300-UTR3 COOR C/11576-12241 HITS FJ873733 [GenBank] TYPE Community cDNA EVAL 99.84 LOCN Exon COOR C/11606-13173,13334-13613 HITS BX814729 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/11649-12972,13011-13175,13338-13613 HITS SALKseq_046278.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/11933-11933 NOTE KO381801 Salk 20K 1:11785 AAATTGAGAGAAAGTGAAGACTTCCCTTTCTTAGCAAATTGATCATCATCGCCATCATCAACAAATTGACGCTTAGACA HITS RATM11-4609-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-174 LOCN 300-UTR3 COOR W/12239-12546