CODE AT1G49730.3 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G49730.3 CDS ID=AT1G49730.3; Parent=AT1G49730; Name=AT1G49730.3; Note=Protein kinase superfamily protein; conf_class=3; computational_description=Protein kinase superfamily protein%3B FUNCTIONS IN: kinase activity%3B INVOLVED IN: protein amino acid phosphorylation%3B LOCATED IN: plasma membrane%3B EXPRESSED IN: 20 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: Protein kinase superfamily protein (TAIR:AT3G19300.1)%3B Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12%3B Bacteria - 1396%3B Metazoa - 17338%3B Fungi - 3422%3B Plants - 5037%3B Viruses - 0%3B Other Eukaryotes - 2996 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12805585, PMID:21181499, PMID:21477822, locus:2012191; locus_type=protein_coding COOR C/18403515-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405013 HITS SALK_036605.36.90.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-148 LOCN 300-UTR3 COOR C/18402997-18403284 HITS SALKseq_133112.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/18403440-18403440 NOTE KO350503 Salk 10K 1:18403324 CTGATTTGATAATATATCTTTTACAGTTTTTGGTTCTTGGCTGCACGTTGTTCTCTCCTCCAGGAATATCTTCATTTCT HITS U87409 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk pUni Clone EVAL 100.00 LOCN Exon COOR C/18403515-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405013 NOTE BT029772 HITS G87409 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/18403515-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405013 NOTE U87409 BT029772 pENTR_Sfi HITS SALKseq_047697.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/18403574-18403574 NOTE KO388572 Salk 30K 1:18403645 AAAAGATATATTATCAAATCAGTTTACAGAGAAAATGTAGATGAAAGACTTTGGAATATTTACCAAAGCATTTGCCAC HITS BX839726 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/18404548-18405386 HITS SAIL_599_C04C1 SAIL T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank (with the exact insertion site info)] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM NG EVAL 2e-117 LOCN 1000-Promotor COOR W/18405424-18405651 NOTE JY127186.1 HITS CSHL_ET13546 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-134 LOCN 1000-Promotor COOR W/18405489-18405769 HITS SAIL_719_F05 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 9e-51 LOCN 1000-Promotor COOR C/18405592-18405749 HITS WiscDsLoxHs052_08D [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 2e-86 LOCN 1000-Promotor COOR W/18405640-18405820 HITS Wiscseq_DsLoxHs052_08D.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/18405640-18405640 NOTE KO452903 Wisc 20K 1:18405662 TTGAATAGTTGACAAGTCTAAAATTTGTCTCTTTCCTTGTCACTTGTCAGTGAGTATACAAAACAATACACAGAGCCTCG HITS SAILseq_719_F05.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/18405750-18405750 NOTE KO329676 SAIL 40K 1:18405784 AGAAACTTGTAGGTTAGAAAGGAGATGAAATGAGAAAGTTAGGGGCTTTAAACAACTTAATAACACATTGCCGCTTGAACAAATTGACGCTTAGACAACT