CODE AT1G49720.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G49720.2 CDS ID=AT1G49720.2; Parent=AT1G49720; Name=AT1G49720.2; Note=abscisic acid responsive element-binding factor 1; curator_summary=Identified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses.; conf_class=3; symbol=ABF1; Alias=AtABF1; full_name=abscisic acid responsive element-binding factor 1; computational_description=abscisic acid responsive element-binding factor 1 (ABF1)%3B FUNCTIONS IN: protein binding%2C DNA binding%2C transcription activator activity%2C sequence-specific DNA binding transcription factor activity%3B INVOLVED IN: abscisic acid mediated signaling pathway%2C regulation of transcription%2C DNA-dependent%2C response to stress%3B LOCATED IN: nucleus%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 12 growth stages%3B CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827)%2C bZIP transcription factor%2C bZIP-1 (InterPro:IPR011616)%3B BEST Arabidopsis thaliana protein match is: ABRE binding factor 4 (TAIR:AT3G19290.1)%3B Has 1956 Blast hits to 1888 proteins in 151 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 452%3B Fungi - 28%3B Plants - 1407%3B Viruses - 0%3B Other Eukaryotes - 69 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10760247, PMID:10636868, PMID:11019812, PMID:11118137, PMID:11906833, PMID:12045268, PMID:16299177, PMID:17921317, PMID:16247556, PMID:20733066, PMID:21181499, PMID:21692804, PMID:22037706, PMID:22041934, PMID:23772380, PMID:23742014, PMID:24738645, locus:2012206; locus_type=protein_coding COOR W/18400826-18401824,18401942-18402013,18402099-18402153,18402277-18402362 HITS CSHL_GT7217 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 1000-Promotor COOR C/18399691-18400243 HITS SALK_038005.45.60.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-90 LOCN 1000-Promotor COOR C/18399692-18399890,18400028-18400097 HITS CSHL_GT25446 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 1000-Promotor COOR W/18399860-18400201 HITS SAIL_143_E05 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 1e-50 LOCN 1000-Promotor COOR W/18399867-18400116 HITS SALK_033987.49.35.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-94 LOCN 1000-Promotor COOR W/18399879-18400053 HITS SAIL_1304_B03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-144 LOCN 1000-Promotor COOR W/18399944-18400201 HITS Wiscseq_DsLox246H04.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/18400053-18400053 NOTE KG796586 Wisc 10K 1:18400098 TGAAAATAGAGAAGAGCTGCGANAGAGAGAAGAGACGACAAGTGTGTTTGTAGTAGCTTCGACACGAACTGCCATTTTAAGGGGTTAACAAATTGACGCT HITS SALK_072942.51.30.x SALK T-DNA Homozygous Knockout Line for At1g49720 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 6e-47 LOCN 1000-Promotor COOR W/18400075-18400168 NOTE At1g49720 HITS SALKseq_038005.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/18400084-18400084 NOTE KO381385 Salk 20K 1:18400085 TAAAATAAAAAACCATAAGAGGAAAAAGCTTAACCCCTTAAAATGGCAGTTCGTGTCGAAGAAACAAATTGACGCTTAG HITS RAFL09-41-C22 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.25 LOCN Exon COOR W/18400092-18400160,18400742-18401824,18401942-18402013,18402099-18402128,18402277-18402618 HITS RAFL09-77-C02 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.76 LOCN Exon COOR W/18400092-18400160,18400742-18401824,18401942-18402013,18402099-18402128,18402277-18402618 HITS R19471 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 98.76 LOCN Exon COOR W/18400092-18400160,18400742-18401824,18401942-18402013,18402099-18402128,18402277-18402618 NOTE BT008647 HITS CSHL_GT25447 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 2e-49 LOCN 1000-Promotor COOR W/18400095-18400201 HITS BX814387 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/18400097-18400156,18400738-18401825,18401943-18402014,18402100-18402126,18402275-18402488 HITS SALK_038065.29.99.f SALK T-DNA Homozygous Knockout Line for At4g36170 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 5e-33 LOCN 1000-Promotor COOR W/18400097-18400168 NOTE At4g36170 HITS SALK_038065.52.95.x SALK T-DNA Homozygous Knockout Line for At4g36170 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 4e-33 LOCN 1000-Promotor COOR W/18400097-18400168 NOTE At4g36170 HITS SALK_084668.29.15.x SALK T-DNA Homozygous Knockout Line for At1g49720 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 9e-19 LOCN 1000-Promotor COOR W/18400106-18400169 NOTE At1g49720 HITS BX816317 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/18400125-18400156,18400738-18401825,18401943-18402014,18402100-18402126,18402275-18402493 HITS SALK_099081.43.80.x SALK T-DNA Homozygous Knockout Line for At1g49720 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-16 LOCN 1000-Promotor COOR W/18400125-18400168 NOTE At1g49720 HITS SALK_038065.52.95.x SALK T-DNA Homozygous Knockout Line for At4g36170 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-12 LOCN 1000-Promotor COOR W/18400134-18400168 NOTE At4g36170 HITS SALKseq_069120.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/18400262-18400262 NOTE KO403099 Salk 50K 1:18400263 ATCCGTTTTCGTTTTCTTTTCTTCTCGAATCTGTCTTTGTCTTATCACATCCCCTGAAGTGTTATACTTTTTTTTTTTT HITS SALKseq_093950.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/18400278-18400278 NOTE KO346504 Salk 20K 1:18400277 AATAGTTACTTCATTACTACTACTACTTGATTTAGAACATAGAACCAAAAAAAAGACAAACAGGATATATTGTGGTGTA HITS GT_5_104508 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL e-124 LOCN 1000-Promotor COOR W/18400340-18400564 NOTE CS167194 HITS GT_5_111308 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL e-129 LOCN 1000-Promotor COOR W/18400340-18400575 NOTE CS172523 HITS AF093544 [GenBank] TYPE Community cDNA EVAL 96.07 LOCN Exon COOR W/18400751-18401824,18401942-18402013,18402099-18402128,18402277-18402616 HITS PYAt1g49720 [Seq] [About Peking Yale TF] [Order from ABRC] (ORF amplified by RT-PCR and cloned into the Gateway( TM) system; 5' and 3' end sequencing has been performed on this clone.) TYPE PY TF EVAL 0.0 LOCN Exon COOR W/18400826-18401247 HITS U19471 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR W/18400826-18401824,18401942-18402013,18402099-18402128,18402277-18402385 NOTE BT008575 HITS G19471 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR W/18400826-18401824,18401942-18402013,18402099-18402128,18402277-18402385 NOTE U19471 BT008575 pENTR_Sfi HITS SALK_043079.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-163 LOCN Exon COOR C/18401171-18401460 HITS SALK_132819.48.65.x SALK T-DNA Homozygous Knockout Line for At1g49720 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-169 LOCN Exon COOR C/18401242-18401580 NOTE At1g49720 HITS SALKseq_132819.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/18401673-18401673 NOTE KO357159 Salk 60K 1:18401674 ATGGGAGGAGCAGGGGGTACTGTTACAGCTACTTCTCCTGGGACGAGCAGGATATATTGTGGTGTAAACAAATTGACGC HITS PYAt1g49720 [Seq] [About Peking Yale TF] [Order from ABRC] (ORF amplified by RT-PCR and cloned into the Gateway( TM) system; 5' and 3' end sequencing has been performed on this clone.) TYPE PY TF EVAL 8e-75 LOCN Exon COOR C/18401676-18401825,18401943-18402014,18402100-18402126,18402275-18402348 HITS FLAG_179D12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 3e-26 LOCN Exon COOR C/18401737-18401799 HITS SK33130 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN Exon COOR W/18401797-18402250 NOTE CS1011911 HITS RAFL09-41-C22 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR W/18401965-18402014,18402100-18402126,18402275-18402618 HITS RAFL09-77-C02 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 2e-40 LOCN Exon COOR W/18402275-18402369,18402546-18402616 HITS SAILseq_735_A09.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/18402334-18402334 NOTE KO326230 SAIL 20K 1:18402380 TACTCTCCCAGTGTCTTCCTTTTGAGTGGTCCTGTATTACATTAGCAGGTTCTTCTTGCTTTGACTTCACCTTCTTACCACGGACCGGTAAGGGT HITS SALK_142713.31.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-32 LOCN 300-UTR3 COOR W/18402443-18402556 HITS BX835758 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 300-UTR3 COOR W/18402506-18403129,18403208-18403289,18403366-18403456,18403561-18403628,18403710-18403759,18403844-18403913 HITS RAFL14-18-M13 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.25 LOCN 300-UTR3 COOR C/18402525-18402892,18403013-18403126,18403205-18403289,18403366-18403455,18403560-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405102,18405470-18405570 HITS RAFL05-21-A05 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN 300-UTR3 COOR C/18402530-18403129,18403208-18403291 HITS R10513 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.23 LOCN 300-UTR3 COOR C/18402530-18403126,18403205-18403289,18403366-18403627,18403709-18403761,18403846-18404110,18404191-18404478,18404548-18405102,18405470-18405568 NOTE AY045832 HITS BX813719 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 300-UTR3 COOR C/18402541-18403129,18403208-18403289,18403366-18403456,18403561-18403628,18403710-18403759,18403844-18404110,18404191-18404478,18404548-18405107,18405475-18405514