CODE AT1G49670.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G49670.2 CDS ID=AT1G49670.2; Parent=AT1G49670; Name=AT1G49670.2; Note=ARP protein (REF); curator_summary=molecular function has not been defined. Was shown involved in oxidative stress tolerance.; conf_class=4; symbol=NQR; computational_description=NQR%3B FUNCTIONS IN: oxidoreductase activity%2C binding%2C catalytic activity%2C zinc ion binding%3B INVOLVED IN: response to oxidative stress%2C metabolic process%3B LOCATED IN: mitochondrion%2C peroxisome%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Short-chain dehydrogenase/reductase%2C conserved site (InterPro:IPR020904)%2C Glucose/ribitol dehydrogenase (InterPro:IPR002347)%2C Alcohol dehydrogenase%2C C-terminal (InterPro:IPR013149)%2C Short-chain dehydrogenase/reductase SDR (InterPro:IPR002198)%2C GroES-like (InterPro:IPR011032)%2C NAD(P)-binding domain (InterPro:IPR016040)%2C Alcohol dehydrogenase GroES-like (InterPro:IPR013154)%2C Quinone oxidoreductase/zeta-crystallin%2C conserved site (InterPro:IPR002364)%2C Alcohol dehydrogenase superfamily%2C zinc-containing (InterPro:IPR002085)%3B BEST Arabidopsis thaliana protein match is: Zinc-binding dehydrogenase family protein (TAIR:AT5G37980.1)%3B Has 139834 Blast hits to 139487 proteins in 3900 species: Archae - 1368%3B Bacteria - 93458%3B Metazoa - 6844%3B Fungi - 8617%3B Plants - 3827%3B Viruses - 2%3B Other Eukaryotes - 25718 (source: NCBI BLink).; conf_rating=***; Dbxref=PMID:7592828, PMID:14701923, PMID:14671022, PMID:17631525, PMID:17951448, PMID:18775970, PMID:18931141, PMID:19043666, PMID:20736450, locus:2012166; locus_type=protein_coding COOR C/18381591-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18383029,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386021 HITS RAFL04-17-J20 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-136 LOCN Exon COOR C/18381262-18381509,18381533-18381642 HITS R15527 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 100.00 LOCN Exon COOR C/18381262-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18382960,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386107 NOTE AY072306 HITS R16734 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 100.00 LOCN Exon COOR C/18381347-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18382960,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386102 NOTE AY062728 HITS RAFL08-18-C20 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 3e-86 LOCN Exon COOR C/18381349-18381509,18381533-18381643,18381850-18381937,18382059-18382106 HITS U16734 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP Gateway Clone EVAL 100.00 LOCN Exon COOR C/18381349-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18382960,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386021 NOTE U16734 AY093342 pENTR-TOPO HITS SALKseq_059397.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/18381364-18381364 NOTE KO399167 Salk 40K 1:18381363 CATCACAAAAATAAAAGAAACAACTGAATAATAGGACGTAAATAAACATAACACATTGACGTAAACAAATTGACGCTT HITS BX818698 [GenBank] [Order] TYPE GSLT cDNA EVAL e-152 LOCN Exon COOR C/18381368-18381643,18381850-18381936,18382057-18382142,18382261-18382336,18382451-18382577,18382653-18382777,18382889-18382962,18383119-18383171 HITS RAFL09-27-K07 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 2e-65 LOCN Exon COOR C/18381376-18381509,18381533-18381640,18381848-18381936,18382057-18382093 HITS RAFL09-29-E22 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 7e-59 LOCN Exon COOR C/18381395-18381509,18381533-18381643,18381850-18381936,18382057-18382113 HITS Wiscseq_DsLox289_292A7.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/18381412-18381412 NOTE KG797395 Wisc 10K 1:18381390 TATTTGATGCTTAAACGATGCAACCTATTATTCAGTTGTTTCTTTTATTTTTGTGATGGTGTAAATGTTACTCCTCTGTTTTTAATGTGGTGTAAACAAA HITS Z49776 [GenBank] TYPE Community cDNA EVAL 92.23 LOCN Exon COOR C/18381437-18381490,18381526-18381641,18381848-18381936,18382041-18382044,18382059-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18382960,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386058 HITS U15527 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR C/18381591-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18382960,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386021 NOTE BT008393 HITS G15527 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/18381591-18381641,18381848-18381934,18382055-18382141,18382260-18382337,18382451-18382579,18382655-18382774,18382886-18382960,18383117-18383212,18383300-18383401,18383469-18383537,18383701-18383827,18383933-18384119,18384473-18384560,18384830-18384906,18385008-18385113,18385202-18385383,18385475-18385648,18385967-18386021 NOTE U15527 BT008393 pENTR_Sfi HITS SALKseq_087927.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/18381593-18381593 NOTE KO435257 Salk 80K 1:18381594 GGAAAAGCTCCACTCATGTATAGACTCCCAAACTGGATTTTGCTTTGTGGATGTTTTGTTTAAACAAATTGACGCTTA HITS SALK_087927.34.35.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Exon COOR W/18381627-18382063 HITS FLAG_545C12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN Intron COOR W/18382218-18382865 HITS SALK_123841.45.45.x SALK T-DNA Homozygous Knockout Line for At1g49670 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Intron COOR C/18382966-18383296 NOTE At1g49670 HITS SALKseq_134930.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/18383296-18383296 NOTE KO353942 Salk 60K 1:18383297 AAATGTCAACTTGTTGCTCATATGGTTTAGTAGTTCTCACCATGTATCCACAGCTGATGCTCAGGATATATTGTGGTGT HITS SALKseq_037547.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/18383851-18383851 NOTE KO394756 Salk 10K 1:18383766 GGAATTTGTGAGACAAGGTGTGTACAATCCTGAAGGAGTGAATAAGCCAGCAGACAACTTACAAATTGACGCTTAGACA HITS SALK_116822.44.90.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-111 LOCN Intron COOR C/18383943-18384145 HITS SALKseq_116822.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/18384145-18384145 NOTE KG793595 Salk 110K 1:18384124 TTTTTCTCATCGGTTATAAGCTCAAAAGCACCTAAAGCAAAAATATGGCAAACACATTGCGGACAACAAATTGACGCTTAGAC HITS RATM12-2314-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 1e-57 LOCN Exon COOR C/18385517-18385628 HITS RATM12-2314-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 7e-82 LOCN Exon COOR W/18385621-18385789 HITS SAILseq_383_H08.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/18385662-18385662 NOTE KO336451 SAIL 30K 1:18385626 ATCAGCGACTGTTACAAAAACTCCTTTCTCTGCACGAGCTCAGCAGAGAGATCGACATACACATAATTGACGCTTAGACAACATAATGTTAGCAG HITS FLAG_513D09 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-155 LOCN Intron COOR W/18385708-18386223 HITS SALK_014601.50.90.x SALK T-DNA Homozygous Knockout Line for At1g49670 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 7e-81 LOCN Intron COOR C/18385784-18385938 NOTE At1g49670 HITS SK24385 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-137 LOCN 300-UTR5 COOR C/18385846-18386111 NOTE CS1007212 HITS SK21847 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 300-UTR5 COOR C/18385851-18386224 NOTE CS1006021 HITS SALK_152224.33.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-121 LOCN 1000-Promotor COOR C/18386016-18386327 HITS FLAG_152B08 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-136 LOCN 300-UTR5 COOR W/18386104-18386348 HITS SALKseq_029878.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/18386120-18386120 NOTE KO364255 Salk 10K 1:18386043 AAATTGGAGCAGAGGTAGAAGATGATGATTGAATTGTTTGATCCTCGACTTAGACAAATTGACGCTTAGACAACTTAAT HITS FLAG_464B11 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 3e-42 LOCN 300-UTR5 COOR W/18386263-18386348 HITS CSHL_ET4522 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 1000-Promotor COOR C/18386409-18386848 HITS CSHL_ET5006 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 1e-38 LOCN 1000-Promotor COOR C/18386410-18386497 HITS CSHL_ET5236 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 1000-Promotor COOR C/18386410-18386848 HITS CSHL_ET4521 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 4e-29 LOCN 1000-Promotor COOR C/18386414-18386497 HITS CSHL_ET4522 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-160 LOCN 1000-Promotor COOR C/18386538-18386846 HITS Wiscseq_DsLox332A07.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/18386939-18386939 NOTE KG799217 Wisc 10K 1:18386939 GATTTGGGTTTCGAAAAAGGAGAAATGAAGAAATGGGGGGAGGAAGGATTGATTTACCAAAGCGGTCCAGATGACCCCGATTTCGAACCTCCAGAGAGTG