CODE AT1G09595.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G09595.1 transcript_region ID=AT1G09595.1; Parent=AT1G09595; computational_description=novel transcribed region; Name=AT1G09595.1; locus_type=novel_transcribed_region COOR C/18394201-18394853 HITS FLAG_435E04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 3e-19 LOCN 300-UTR3 COOR W/18394035-18394081 HITS GABI_216B03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-84 LOCN Exon COOR W/18394595-18394832 NOTE - - HITS SALK_105726.53.90.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-45 LOCN Exon COOR C/18394606-18394697 HITS SALK_114095.54.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-167 LOCN 1000-Promotor COOR C/18394954-18395249 HITS SALKseq_105726.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/18395015-18395015 NOTE KG787994 Salk 100K 1:18394983 ATGTATGGAAAGAACTCCCTCGAAGAAAAAATACATTGTGTAGGATGAAATAGATGATTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTG HITS GABI_859B12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-119 LOCN 1000-Promotor COOR W/18395205-18395436 NOTE - - HITS SALKseq_113766.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/18395257-18395257 NOTE KG791841 Salk 100K 1:18395231 ATTTCTGATGATCAAAGAAAAGAAAAAACAAAAAAAAGGGATCATAAAAAATTATTGTGAATCTGAGATATTGAGAATTCTCTTAGACAACTTAATAACA