CODE AT1G08765.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G08765.2 transcript_region ID=AT1G08765.2; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.2; locus_type=novel_transcribed_region COOR W/77727-79340 HITS GABI_100D05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-152 LOCN 1000-Promotor COOR C/76773-77047 NOTE - - HITS GABI_177C02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-37 LOCN 1000-Promotor COOR W/77000-77077 NOTE - - HITS SK34859 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 7e-54 LOCN 1000-Promotor COOR C/77055-77161,77073-77159 NOTE CS1012768 HITS SAIL_528_A03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR5 COOR C/77055-77519 HITS SALK_064577.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR5 COOR C/77109-77456 HITS SAILseq_528_A03.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/77465-77465 NOTE KO330767 SAIL 30K 1:77463 CCGCCAATCGTATGTAGCAACCGGGTTTCCTTTTTGGCTGAAACATCTTTTTGAGAAAGAAAGAAGTATTGCTTAGTGTAATACTCATTGTGGTT HITS SALKseq_46135.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/77482-77482 NOTE KO451947 Salk 50K 1:77482 TTTTTTATTTTTTTTTCATTGAAAGATATATTTTATATTCAAGATTGTAACCAAATATACAAAAAGCCTTATTCAAGAT HITS Wiscseq_DsLox384A3.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/77529-77529 NOTE KG802156 Wisc 10K 1:77542 AAAGAAGTATTGCTTAGTGAAATACTCATTGTGGTTGATCTAGAATGATTGTCCTTGATCCTAACTTTTTGTATATTTGGTTACAGTCTTGCATATAAAA HITS SALKseq_064578.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/77534-77534 NOTE KO366008 Salk 50K 1:77535 CTAGAATGATTGTCCTTGATCCTAACTTTTTGTATATTTGGTTACAGTCTTGAATATAAAATATATTGTGGTGTAAACA HITS GABI_171B10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-99 LOCN Exon COOR C/77545-77731 NOTE - - HITS SALKseq_082447.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/77547-77547 NOTE KO424288 Salk 80K 1:77543 TCTTACAATCTCGTATTAGGCCCAATTATGTTTAATTGTAATTCTGCTTTGCTTAGAGGTTGTGCTTTTTTTTTTTTT HITS SAIL_91_F03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 4e-38 LOCN Exon COOR C/77584-77832 HITS SAIL_63_C09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 6e-71 LOCN Exon COOR C/77606-77764 HITS SALK_005299.53.05.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-35 LOCN 300-UTR5 COOR W/77617-77692 HITS SALK_005300.54.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-36 LOCN 300-UTR5 COOR W/77617-77692 HITS SALK_005301.32.25.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-13 LOCN 300-UTR5 COOR W/77617-77670 HITS SALK_005305.53.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-36 LOCN 300-UTR5 COOR W/77617-77692 HITS SALK_005317.19.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-17 LOCN 300-UTR5 COOR W/77621-77692 HITS SALK_005317.29.99.f [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-16 LOCN 300-UTR5 COOR W/77621-77692 HITS WiscDsLoxHs033_02B [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 2e-12 LOCN Exon COOR W/77802-77853 HITS GABI_089D01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-132 LOCN Exon COOR C/78627-78891 NOTE - CS408485 HITS SALKseq_084456.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/78652-78652 NOTE KO424668 Salk 80K 1:78649 ATATTGAGTTGTCTTTGACAATATTTTAAACTAGTTGTAAATCACAGAGATAAACACCATAACAAATTGACGCTTAGA HITS SALK_003854.48.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-11 LOCN Exon COOR W/78696-78757 HITS SALKseq_066022.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/78809-78809 NOTE KO359405 Salk 50K 1:78810 TGCATATTTAGTTTAAATACAAATAAACGAAACAAAAAGCAAAAAGCATAGACGGATCCGTAAATCTACT HITS GABI_089D01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-143 LOCN Exon COOR W/78969-79232 NOTE - CS408485 HITS GABI_089E07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-127 LOCN Exon COOR W/78969-79233 NOTE - - HITS GABI_089F03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-145 LOCN Exon COOR W/78969-79232 NOTE - - HITS GABI_521A10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-131 LOCN 300-UTR3 COOR C/79230-79513 NOTE - - HITS SALK_005730.24.95.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-42 LOCN 300-UTR3 COOR C/79400-79517 HITS SALK_006073.42.15.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-35 LOCN 300-UTR3 COOR C/79402-79475 HITS WiscDsLox500B03 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 300-UTR3 COOR W/79632-80163