CODE AT1G07577.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G07577.1 transcript_region ID=AT1G07577.1; Parent=AT1G07577; computational_description=novel transcribed region%3B detected in carpel%2C light-grown seedling; Name=AT1G07577.1; locus_type=novel_transcribed_region COOR C/18388240-18388692 HITS GABI_634G02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-12 LOCN 300-UTR3 COOR W/18388111-18388196 NOTE - - HITS SAIL_1295_G06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR3 COOR W/18388135-18388523 HITS SALKseq_055154.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/18388139-18388139 NOTE KO382219 Salk 30K 1:18388138 ATATGTCTTCTCTTTTGCTCTAGGTTAATGAGTAATATATAGCAAAGAAATCTATTTTTATTGTAAATGAAAATTAAA HITS GABI_804C12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-10 LOCN 300-UTR3 COOR W/18388161-18388196 NOTE - - HITS SALK_093113.36.90.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-13 LOCN Exon COOR C/18388245-18388295 HITS SALKseq_091054.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/18388274-18388274 NOTE KO439098 Salk 80K 1:18388225 GAGTAATAGCAATGCTTAAAGTGTCATTAATTCTGAGGTATCTGAAAACCATTTTTAATAACAAATTGACGCTTAGAC HITS SALKseq_137425.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/18388533-18388533 NOTE KO400899 Salk 20K 1:18388445 TGAAAGAAAATTGGTACCTGATCTTATCTCTTCTCCCACTTCTCCTCTGTTTTGAAGCTCCAGGATATATTGTGGTGTA HITS GABI_529A03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-32 LOCN 300-UTR5 COOR C/18388652-18388733 NOTE - - HITS SALKseq_075696.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/18388673-18388673 NOTE KO343110 Salk 70K 1:18388672 TTACTCTTAAGAGGAAAAAATCTATAACTCTTGTATTTACATATTCGTTTTTTCAGTTATTGTGGTGTAAACAAATTGA HITS SALKseq_084930.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/18388809-18388809 NOTE KO434695 Salk 80K 1:18388769 GATCCAAAAAAAAGTGATGGCTCAGTTGGAGTCGGCCTAATGGGTCATAGTGGGGTGGTTAAACAAATTGACGCTTAG HITS SALKseq_033372.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/18389166-18389166 NOTE KO357727 Salk 10K 1:18389121 AAGTTTGTTCCTTCCGATGTGGGACTTTAGTGTCTCTAATACATGATGCTTTTAAACATATTGTGGTGTAAACAACTTG HITS SALKseq_047090.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/18389169-18389169 NOTE KO361746 Salk 20K 1:18389147 CTTTAGTGTCTCTAATACATGATGCTTTTTCAAAATCACGTATTGAGCTGTTGGCTGACAGGATATATTGTGGTGTAAA HITS SALK_033372.50.15.x SALK T-DNA Homozygous Knockout Line for At1g49700 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 4e-84 LOCN 1000-Promotor COOR W/18389200-18389419 NOTE At1g49700