CODE AT1G04023.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G04023.1 lnc_RNA ID=AT1G04023.1; Parent=AT1G04023; Name=AT1G04023.1; locus_type=long_noncoding_rna COOR C/91356-91685 HITS FLAG_250G01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN Exon COOR C/91173-91546 HITS SAILseq_587_F04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/91386-91386 NOTE KO332976 SAIL 30K 1:91314 AAAAGCCCAAAGGCCCAAATATGAAAAGCTCGCTTATCTTTTATTGGCGTGCGGACTGAACTGATTGATGGATATATTGTGGTGTAAACAAATTG HITS GABI_060H05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-24 LOCN Exon COOR W/91389-91452 NOTE - - HITS BX815033 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/91410-91632,91742-92067,92268-92936,93045-93171,93271-93406,94695-95076,95160-95631 HITS SALK_008654.43.35.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Exon COOR W/91657-92019 HITS RATM15-2829-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-118 LOCN 1000-Promotor COOR W/92204-92480