CODE AT1G04017.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G04017.1 lnc_RNA ID=AT1G04017.1; Parent=AT1G04017; Name=AT1G04017.1; locus_type=long_noncoding_rna COOR C/90169-90401 HITS BX834170 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/89801-90579 HITS RATM13-0672-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 300-UTR5 COOR C/89834-90483 HITS SK19308 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 1e-33 LOCN 300-UTR3 COOR C/89850-89970 NOTE CS1004757 HITS RATM13-4049-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 1000-Promotor COOR C/90145-90850 HITS SALKseq_066890.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/90145-90145 NOTE KO415629 Salk 50K 1:90145 ATCTTAAGCTGTGGAGTTACCTGAGTTTGCAGAGTGAGGTTAGAATTGATTCTGGTTAGAATGTAGATTGCCTTAGCCATAGAACGTAAACGTTA HITS GABI_938C10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 7e-80 LOCN 1000-Promotor COOR C/90536-90765 NOTE - - HITS SAILseq_587_F04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/91386-91386 NOTE KO332976 SAIL 30K 1:91314 AAAAGCCCAAAGGCCCAAATATGAAAAGCTCGCTTATCTTTTATTGGCGTGCGGACTGAACTGATTGATGGATATATTGTGGTGTAAACAAATTG HITS GABI_060H05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-24 LOCN 1000-Promotor COOR W/91389-91452 NOTE - -