CODE AT1G04013.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G04013.1 antisense_lncRNA ID=AT1G04013.1; Parent=AT1G04013; Name=AT1G04013.1; description=Natural antisense transcript overlaps with AT1G01170; Note=Natural antisense transcript overlaps with AT1G01170; locus_type=antisense_long_noncoding_rna COOR W/74435-74683 HITS WiscDsLox343B03 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR C/73056-73437 HITS Wiscseq_DsLox343B03.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/73464-73464 NOTE KG799953 Wisc 10K 1:73442 ACAGCTGTCGCTGCCCAGGTTGTTTGTGATGATAAAACTCAATTGCGATCTATCACAGAAATTTAATGTTGTTTGGGGGTTTGCTTAGACAACTTAATAA HITS BX839078 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/73533-74252,74340-74592 HITS BX818169 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/73931-74252,74340-74457,74663-74705 HITS CSHL_GT8883 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/74005-74438 HITS RAFL19-52-C06 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.82 LOCN Exon COOR C/74008-74250,74338-74455,74661-74717 HITS U82027 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk pUni Clone EVAL 100.00 LOCN Exon COOR C/74105-74250,74338-74443 NOTE BT024529 HITS G82027 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/74105-74250,74338-74443 NOTE U82027 BT024529 pENTR_Sfi HITS SALKseq_071710.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/74216-74216 NOTE KO356396 Salk 50K 1:74141 CATGCTTGGAATTTCTCATCCGTTGCTGCCCACTCCAGGATATATATATTGCGGACAAATATATTGTGGTGTAAACAA HITS SALK_071710.54.50.x SALK T-DNA Homozygous Knockout Line for At1g01170 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN 300-UTR5 COOR W/74255-74661 NOTE At1g01170 HITS CSHL_GT8883 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 3e-08 LOCN Exon COOR C/74428-74477 HITS GABI_460E09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-104 LOCN 300-UTR3 COOR C/74566-74767 NOTE - - HITS FLAG_457A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 1e-44 LOCN Exon COOR W/74672-74761 HITS SALK_073411.49.55.x SALK T-DNA Homozygous Knockout Line for At1g01170 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-15 LOCN 300-UTR3 COOR C/74714-74754 NOTE At1g01170 HITS SALK_005093.42.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-44 LOCN 300-UTR3 COOR C/74714-74802 HITS SALK_066235.47.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-42 LOCN 300-UTR3 COOR C/74714-74799 HITS SALK_005101.26.45.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-06 LOCN 300-UTR3 COOR C/74726-74783 HITS FLAG_431F07 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-107 LOCN 300-UTR3 COOR C/74762-74956 HITS SALKseq_48933.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/74773-74773 NOTE KO450284 Salk 50K 1:74780 GTCATGATTGTAGTTTTGTCTCTTAATAAAACTAGTAATTAACGTTTCAGAAAACAATGCCCATTTTGGTAATTTCTCAGGATATATTGTGGTGTATACA HITS Wiscseq_DsLox350B02.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/74877-74877 NOTE KG800248 Wisc 10K 1:74932 TCTCTGTGAAATTACCAAAATGGGCATTGTTTTCTGAAACGTTAATTACTAGTTTTATTAAGAGACAAAACTACAATCATCACAAGGGAAGATATAATAG HITS FLAG_480C01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 2e-15 LOCN 300-UTR3 COOR W/74963-75016