CODE AT1G04007.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G04007.1 antisense_lncRNA ID=AT1G04007.1; Parent=AT1G04007; Name=AT1G04007.1; description=Natural antisense transcript overlaps with AT1G01160; Note=Natural antisense transcript overlaps with AT1G01160; locus_type=antisense_long_noncoding_rna COOR C/72646-73108 HITS SALKseq_032830.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/72349-72349 NOTE KO361047 Salk 10K 1:72205 ATTTGGTTAGAGGTTGCTCGTTGCTGTATTAATTAATGTTTTATGTTTTCGTTTAGAGTTTTGTAAACAAATTGACGCT HITS BX841803 [GenBank] [Order] TYPE GSLT cDNA EVAL e-172 LOCN Exon COOR W/72357-72669,73087-73163,73287-73393,73486-73741,73822-74096 HITS RAFL04-13-H03 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/72376-72844 HITS AY102640 [GenBank] TYPE Community cDNA EVAL 98.56 LOCN Exon COOR W/72379-72669,73087-73163,73287-73395,73488-73740,73822-74050 HITS RAFL06-13-G16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-136 LOCN Exon COOR C/72418-72669,73087-73163,73287-73393,73486-73718 HITS R13413 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.89 LOCN Exon COOR W/72419-72669,73087-73163,73287-73395,73488-73740,73822-74046 NOTE AF410307 HITS BX835419 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/72431-73401 HITS U13413 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 NOTE AY102133 HITS G13413 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 NOTE U13413 AY102133 pENTR_Sfi HITS SAIL_328_A03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-74 LOCN Exon COOR C/72883-73076 HITS WiscDsLox343B03 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR C/73056-73437 HITS Wiscseq_DsLox343B03.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/73464-73464 NOTE KG799953 Wisc 10K 1:73442 ACAGCTGTCGCTGCCCAGGTTGTTTGTGATGATAAAACTCAATTGCGATCTATCACAGAAATTTAATGTTGTTTGGGGGTTTGCTTAGACAACTTAATAA HITS BX839078 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR C/73533-74252,74340-74592 HITS BX818169 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR C/73931-74252,74340-74457,74663-74705 HITS RAFL19-52-C06 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.82 LOCN 1000-Promotor COOR C/74008-74250,74338-74455,74661-74717 HITS U82027 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk pUni Clone EVAL 100.00 LOCN 1000-Promotor COOR C/74105-74250,74338-74443 NOTE BT024529 HITS G82027 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN 1000-Promotor COOR C/74105-74250,74338-74443 NOTE U82027 BT024529 pENTR_Sfi