CODE AT1G03997.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G03997.1 antisense_lncRNA ID=AT1G03997.1; Parent=AT1G03997; Name=AT1G03997.1; description=Natural antisense transcript overlaps with AT1G01050; Note=Natural antisense transcript overlaps with AT1G01050; locus_type=antisense_long_noncoding_rna COOR W/32727-33009 HITS U13796 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN 300-UTR5 COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 NOTE BT001144 HITS G13796 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN 300-UTR5 COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 NOTE U13796 BT001144 pENTR_Sfi HITS SAIL_545_C05 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR C/31679-32304 HITS FLAG_083C10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 4e-29 LOCN 1000-Promotor COOR C/31889-31952 HITS GABI_759C11 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-11 LOCN 1000-Promotor COOR W/32401-32434 NOTE - - HITS SALK_093663.35.35.x SALK T-DNA Homozygous Knockout Line for At1g01050 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Exon COOR C/32509-32928 NOTE At1g01050 HITS GABI_750E08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-98 LOCN Exon COOR C/32511-32695,32767-32946 NOTE - - HITS SALKseq_13109.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/32931-32931 NOTE KO440109 Salk 20K 1:32755 CTGAAAAGATGTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGACGCTTAGACAACTTAATACACTGA HITS GABI_750E08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-94 LOCN Exon COOR W/32946-33119 NOTE - - HITS GABI_814C02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 6e-12 LOCN 300-UTR3 COOR W/33080-33118 NOTE - -