CODE AT1G03993.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G03993.1 antisense_lncRNA ID=AT1G03993.1; Parent=AT1G03993; Name=AT1G03993.1; description=Natural antisense transcript overlaps with AT1G01040; Note=Natural antisense transcript overlaps with AT1G01040; locus_type=antisense_long_noncoding_rna COOR C/23312-24099 HITS SALKseq_085706.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/23062-23062 NOTE KO421588 Salk 70K 1:23008 TAAATAAGTTACTTTTTACAAAGTCGAATAAATTATTTACCCTTCTGCTTTAATGGCAATTGACGCTTAGACAACTTAA HITS AF292941 [GenBank] TYPE Community DNA EVAL 99.93 LOCN Exon COOR W/23066-31204 HITS SALK_085706.54.10.x SALK T-DNA Homozygous Knockout Line for At1g01040 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN 300-UTR3 COOR W/23084-23514 NOTE At1g01040 HITS CSHL_ET1887 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 300-UTR3 COOR W/23118-23446 HITS SALKseq_31431.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/23125-23125 NOTE KO440538 Salk 40K 1:23124 TTCTGAGATTCCACGGTCTATCGATCCCTACTCTGTTCTGTTTCTCTCTTCGTCTTCCTCTCTCTTCTGGTCTGTTTT HITS SALK_132615.52.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR3 COOR W/23125-23505 HITS AF292940 [GenBank] TYPE Community cDNA EVAL 99.89 LOCN Exon COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31153 HITS JN661701 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31227 HITS JN661702 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27687-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31227 HITS SALKseq_056243.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/23270-23270 NOTE KO345459 Salk 30K 1:23199 GCAAAAGGGTTTTCAATTCCTATTTATTTACAAAGAAATCATCAATAGTTGTGGTGTAAACAAATTGACGCTTAGACA HITS SALK_056243.55.75.x SALK T-DNA Homozygous Knockout Line for At1g01040 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Exon COOR W/23316-23733 NOTE At1g01040 HITS AF187317 [GenBank] TYPE Community cDNA EVAL 99.97 LOCN Exon COOR W/23510-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31155 HITS SALKseq_109692.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/23869-23869 NOTE KG789931 Salk 100K 1:23922 TGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAATTGACGCTTAGACAA HITS SALK_081595.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR5 COOR C/23968-24388 HITS SALKseq_081595.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/24388-24388 NOTE KO437366 Salk 70K 1:24324 AAAGACACTTATCGCGACTCTTCTTATTAAAAGTGTTCATAAGGATCTGGGGTGGTTTTGGTGTAAACAAATTGACGCT HITS SAIL_442_D10 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-147 LOCN 1000-Promotor COOR W/24511-24829 HITS FLAG_380A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-177 LOCN 1000-Promotor COOR W/24641-24957 HITS FLAG_008A09 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 5e-44 LOCN 1000-Promotor COOR C/24958-25049 HITS FLAG_278A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 9e-46 LOCN 1000-Promotor COOR C/24958-25049 HITS FLAG_278C09 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 9e-46 LOCN 1000-Promotor COOR C/24958-25049