CODE AT1G01240.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01240.2 CDS ID=AT1G01240.2; Parent=AT1G01240; Name=AT1G01240.2; Note=transmembrane protein; conf_class=2; computational_description=unknown protein%3B INVOLVED IN: N-terminal protein myristoylation%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 11 growth stages%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G46550.1)%3B Has 95 Blast hits to 78 proteins in 16 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 11%3B Fungi - 0%3B Plants - 80%3B Viruses - 0%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:12912986, PMID:15703057, PMID:23517122, locus:2035242; locus_type=protein_coding COOR W/100683-101678 HITS GABI_086F12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-115 LOCN 1000-Promotor COOR W/99783-99996 NOTE - - HITS GABI_086H10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-116 LOCN 1000-Promotor COOR W/99783-99996 NOTE - - HITS SALKseq_057922.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/99825-99825 NOTE KO382360 Salk 40K 1:99761 GATTCTCTCTTTAGCCAACACGTGTTGTCAATCCAGCTGTTTCAGATGCTTACCAAGAAATTGACGCTTAGACAACTT HITS SALK_004740.41.35.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-15 LOCN 1000-Promotor COOR W/99834-99875 HITS SALK_004750.43.45.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-15 LOCN 1000-Promotor COOR W/99834-99875 HITS SALK_096370.51.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-16 LOCN 1000-Promotor COOR W/99834-99875 HITS SALK_057922.40.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-14 LOCN 1000-Promotor COOR W/99837-99875 HITS SALK_057922.44.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-14 LOCN 1000-Promotor COOR W/99837-99875 HITS CSHL_ET11583 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 1000-Promotor COOR W/99861-100524 HITS SALK_104275.33.95.x SALK T-DNA Homozygous Knockout Line for At1g01240 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 6e-26 LOCN 1000-Promotor COOR C/99872-100018 NOTE At1g01240 HITS BX837698 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 300-UTR5 COOR W/99894-100647 HITS R14913 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.84 LOCN Exon COOR W/99922-100031,100657-101832 NOTE AF428444 HITS R11287 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 96.59 LOCN Exon COOR W/99936-100031,100657-101805 NOTE AY056171 HITS AY087324 [GenBank] TYPE Community cDNA EVAL 99.58 LOCN Exon COOR W/99986-100031,100657-101801 HITS BX818598 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/100001-100030,100656-101694 HITS BX815637 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/100031-100219,100656-101749 HITS SALKseq_042710.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/100256-100256 NOTE KO395004 Salk 20K 1:100255 TGCAGAACCAAAAAAAAAGAAAGTCTTGAGCAGAGCAAACTACAAAGATCATATTGCCAAAACAAATTGACGCTTAGAC HITS Wiscseq_DsLoxHs075_11B.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/100478-100478 NOTE KG813655 Wisc 20K 1:100478 TGTTTAAGATTTCATATACGTTGAATTGGTTTTGATTGAATATATTTTGGTTCCCAGACGTTGCGTGTATTATTTAATGT HITS U11287 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR W/100683-101709 NOTE AY091196 HITS G11287 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR W/100683-101709 NOTE U11287 AY091196 pENTR_Sfi HITS BX834584 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/101160-101780 HITS GABIseq_025D05.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/101214-101214 NOTE KG780212 GABI 10K 1:101191 AAACTCCACAAGAGTATTCACTCCTCGAGCGGAGAAAAAGGGTTTAAAACAGCGGTTAAATCGCCATGGAAGCAAGGAGTTTCATGTCCGGGAAATCTAC HITS RAFL08-14-L09 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR W/101376-101802 HITS Wiscseq_DsLox465H10.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/101415-101415 NOTE KG806792 Wisc 10K 1:101393 TTCTCAAACCAGGGCAAGAGAAGCAGAGAGAGCAGCGAGAGAAGCTTGCGCTGAGAAAGACCGTGTGATAACAATCTGGACGCATTGACGCTTAGACAAC HITS SALK_035378.45.65.x SALK T-DNA Homozygous Knockout Line for At1g01240 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 8e-18 LOCN Exon COOR C/101464-101544 NOTE At1g01240 HITS RAFL09-08-A10 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-109 LOCN Exon COOR W/101533-101757 HITS RAFL09-71-K16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 5e-95 LOCN Exon COOR W/101637-101832 HITS SALKseq_035378.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/101831-101831 NOTE KO407999 Salk 10K 1:101821 TAAAATTGTGTGTATATTTTGTTAATGTATGTATTGTGTGATGTTTGTGTAAATTTAATCTTCTGTAGAAGTTTATTTG