CODE AT1G01230.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01230.1 CDS ID=AT1G01230.1; Parent=AT1G01230; Name=AT1G01230.1; Note=ORMDL family protein; conf_class=2; computational_description=ORMDL family protein%3B FUNCTIONS IN: molecular_function unknown%3B INVOLVED IN: protein folding%3B LOCATED IN: integral to membrane%2C endoplasmic reticulum%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: ORMDL (InterPro:IPR007203)%3B BEST Arabidopsis thaliana protein match is: ORMDL family protein (TAIR:AT5G42000.1)%3B Has 538 Blast hits to 538 proteins in 163 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 148%3B Plants - 90%3B Viruses - 0%3B Other Eukaryotes - 24 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:18775970, locus:2035352; locus_type=protein_coding COOR W/97620-97805,98457-98605,98908-99046 HITS SALKseq_55069.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/96665-96665 NOTE KO447685 Salk 60K 1:96666 CATCAACATCATCAATATCATCATCTTCCTCTGAAGATATCTGTTCCATATTGTGGTGTAAACAAATTGACGCTTAGAC HITS SALKseq_043785.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/96728-96728 NOTE KO388358 Salk 20K 1:96727 AAACCGATGGACTGACTCCATATTCGAAGCAGTAGAGTGAGCCGTTCTTGAAACCGATGGACAGGATATATTGTGGTGT HITS SALK_043785.40.90.x SALK T-DNA Homozygous Knockout Line for At1g01225 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-107 LOCN 1000-Promotor COOR W/96728-96981 NOTE At1g01225 HITS WiscDsLoxHs198_05F [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR C/96758-97248 HITS SAIL_15_B09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR W/96880-97117,97365-97755 HITS SK12384 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-174 LOCN 300-UTR5 COOR W/97435-97751 NOTE CS1002164 HITS SK12642 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-179 LOCN 300-UTR5 COOR W/97435-97750 NOTE CS1002178 HITS SK12847 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-180 LOCN 300-UTR5 COOR W/97435-97753 NOTE CS1002201 HITS SK13034 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-180 LOCN 300-UTR5 COOR W/97435-97753 NOTE CS1002231 HITS SK13074 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-173 LOCN 300-UTR5 COOR W/97435-97741 NOTE CS1002234 HITS SK13141 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 300-UTR5 COOR W/97435-97755 NOTE CS1002249 HITS SK14027 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-180 LOCN 300-UTR5 COOR W/97435-97753 NOTE CS1002354 HITS SK14034 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-179 LOCN 300-UTR5 COOR W/97435-97750 NOTE CS1002356 HITS SK14503 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 300-UTR5 COOR W/97435-97756 NOTE CS1002370 HITS GABI_322D03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN 300-UTR5 COOR W/97457-97890 NOTE - - HITS SALKseq_030992.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/97459-97459 NOTE KO347598 Salk 10K 1:97458 TATTTCGGCGAGAACAAGGATTGTTTGTTTCTTTGGTTTAATTTTGTGTGCCCGTGAAAGACAACTTAATAACAAATTG HITS AY085212 [GenBank] TYPE Community cDNA EVAL 99.38 LOCN Exon COOR W/97476-97805,98457-98605,98908-99237 HITS GABI_143A01 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN Intron COOR C/97508-98014 NOTE at1g01230 CS413633 HITS R09203 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 97.86 LOCN Exon COOR W/97509-97805,98457-98605,98908-99239 NOTE AF360237 HITS U09203 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 99.79 LOCN Exon COOR W/97620-97805,98457-98605,98908-99045 NOTE AY040036 HITS G09203 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 99.79 LOCN Exon COOR W/97620-97805,98457-98605,98908-99045 NOTE U09203 AY040036 pENTR_Sfi HITS GABI_322D03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-168 LOCN Exon COOR W/97620-97930 NOTE - - HITS SALK_046182.46.60.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-139 LOCN Intron COOR C/97653-98087 HITS SALK_046054.46.60.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-138 LOCN Intron COOR C/97663-98087 HITS GABI_143A01 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL e-119 LOCN Exon COOR W/97703-97934 NOTE at1g01230 CS413633 HITS WiscDsLoxHs028_08G [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 2e-58 LOCN Intron COOR C/97753-98023 HITS SALKseq_046054.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR W/98110-98110 NOTE KO368385 Salk 20K 1:98109 ATCAACTCAACAGTCAACACTGCTGATAGTATCCAAACAGATCAATTCAAAATCGCTGAACACATTGACGCTTAGACAA HITS SALK_203148 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 9e-137 LOCN Intron COOR W/98110-98372 NOTE JY127679.1 HITS RAFL09-17-B06 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR W/98508-98605,98908-99239 HITS SAILseq_903_A06.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/98594-98594 NOTE KO325321 SAIL 40K 1:98666 TTGCTAAGAAAATATAGATTGGAAATAGACAAGAGTGGTGAGATTTTGAGGAACAAGGTGCTGGGACTTACAGAACAACAGGATATATTGTGGTGTAAAC HITS GABI_099G02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-173 LOCN 300-UTR3 COOR C/98782-99095 NOTE - - HITS GABI_099H02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 8e-37 LOCN 300-UTR3 COOR C/98782-98875,99052-99098 NOTE - - HITS SALKseq_059012.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/98988-98988 NOTE KO399145 Salk 40K 1:98883 ACAACAGATTACAGACATCCATGGCTGTTCCTCAACACACTCGCTGTGATGGTTCTCGTTGTGGTGTAAACAAATTGA HITS SALK_203765 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 1e-129 LOCN Exon COOR W/99012-99261 NOTE JS805651.1 HITS FLAG_528A04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 300-UTR3 COOR W/99150-99654 HITS SALKseq_052873.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/99282-99282 NOTE KO408832 Salk 30K 1:99216 AGCTTTCCCTTCATCTCCCCACTTCACTTCAGATAATGGGCCTAATAGCAATATGTGGTGTAAACAAATTGACGCTTA