CODE AT1G01225.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01225.1 CDS ID=AT1G01225.1; Parent=AT1G01225; Name=AT1G01225.1; Note=NC domain-containing protein-like protein; conf_class=1; computational_description=NC domain-containing protein-related%3B CONTAINS InterPro DOMAIN/s: NC (InterPro:IPR007053)%3B BEST Arabidopsis thaliana protein match is: NC domain-containing protein-related (TAIR:AT4G00905.1)%3B Has 173 Blast hits to 172 proteins in 34 species: Archae - 0%3B Bacteria - 24%3B Metazoa - 5%3B Fungi - 0%3B Plants - 139%3B Viruses - 0%3B Other Eukaryotes - 5 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, PMID:22589469, locus:505006091; locus_type=protein_coding COOR W/96064-96157,96554-97242 HITS CSHL_GT14967 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 300-UTR5 COOR C/95118-95829 HITS GABI_151E09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-75 LOCN 1000-Promotor COOR C/95166-95346 NOTE - - HITS SAILseq_897_G01.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/95186-95186 NOTE KO329964 SAIL 40K 1:95243 TCGCCAGCTCCGTCAATCGCTTAATGCTTGAAATTAGGAGATTATCTCTTTGCAAATACCTTGTAACGACCTTGATATTGTGGTGTAAACAAATTAACGC HITS SALK_050563.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-147 LOCN 1000-Promotor COOR C/95320-95622 HITS SALK_050582.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR C/95321-95725 HITS SALK_066087.47.05.x SALK T-DNA Homozygous Knockout Line for At1g01225 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-161 LOCN 300-UTR5 COOR C/95414-95699,95801-95907 NOTE At1g01225 HITS SALK_066088.20.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-43 LOCN 300-UTR5 COOR C/95508-95696,95833-95929 HITS Wiscseq_DsLox386F09.4 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/95630-95630 NOTE KG802399 Wisc 10K 1:95604 TACAGTGTCAGTGTGTCATCATCTTGATTCTTGTAAATTGATATATTTTTTTGGGACCTTTGGAAAAAATTAATAACACATTGACGCTTAGACGACTTAA HITS SAIL_287_A04 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR W/95723-96507 HITS GABI_836F11 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-26 LOCN 300-UTR5 COOR C/95817-95908 NOTE - - HITS CSHL_GT14967 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 300-UTR5 COOR W/95822-96561 HITS SALKseq_067509.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/95879-95879 NOTE KO376238 Salk 50K 1:95724 GGTAGCATTTGGATTTGGAGATAACGCCGTTAAAAGACTCTGTAACGGGTTTGCTATTACTGACGCTTAGACAACTTA HITS GABI_425B07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-15 LOCN 300-UTR5 COOR C/95893-95936 NOTE - - HITS GABI_027D06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-104 LOCN Exon COOR C/95897-96087 NOTE - - HITS GABI_294F04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 6e-37 LOCN 300-UTR5 COOR C/95897-95974 NOTE - - HITS GABI_053F12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-177 LOCN 300-UTR5 COOR W/95946-96327 NOTE - - HITS BX818287 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/95987-96156,96553-97387 HITS AY087072 [GenBank] TYPE Community cDNA EVAL 99.90 LOCN Exon COOR W/96020-96157,96554-97397 HITS RATM12-3060-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 3e-30 LOCN Exon COOR C/96032-96120 HITS GT_5_32345 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL e-115 LOCN Intron COOR C/96060-96284 NOTE CS129221 HITS U83892 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk pUni Clone EVAL 100.00 LOCN Exon COOR W/96064-96157,96554-97242 NOTE BT024776 HITS G83892 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR W/96064-96157,96554-97242 NOTE U83892 BT024776 pENTR_Sfi HITS GABI_168B03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-88 LOCN Exon COOR W/96064-96255 NOTE - - HITS GT_5_32414 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL e-145 LOCN Intron COOR C/96065-96324 NOTE CS129250 HITS GABI_040F05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN Exon COOR W/96066-96505 NOTE - - HITS GT_5_32440 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL e-144 LOCN Intron COOR C/96068-96324 NOTE CS129259 HITS BX838177 [GenBank] [Order] TYPE GSLT cDNA EVAL e-117 LOCN Exon COOR W/96076-96156,96553-96969 HITS RATM12-3060-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR W/96113-96869 HITS GABI_425B07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-74 LOCN Intron COOR W/96171-96327 NOTE - - HITS GABI_053F12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 8e-72 LOCN Intron COOR W/96187-96326 NOTE - - HITS GABI_168B03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 8e-17 LOCN Intron COOR W/96284-96326 NOTE - - HITS GABI_654F08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN Intron COOR W/96335-96805 NOTE - - HITS SALKseq_55069.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/96665-96665 NOTE KO447685 Salk 60K 1:96666 CATCAACATCATCAATATCATCATCTTCCTCTGAAGATATCTGTTCCATATTGTGGTGTAAACAAATTGACGCTTAGAC HITS SALKseq_043785.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/96728-96728 NOTE KO388358 Salk 20K 1:96727 AAACCGATGGACTGACTCCATATTCGAAGCAGTAGAGTGAGCCGTTCTTGAAACCGATGGACAGGATATATTGTGGTGT HITS SALK_043785.40.90.x SALK T-DNA Homozygous Knockout Line for At1g01225 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-107 LOCN Exon COOR W/96728-96981 NOTE At1g01225 HITS WiscDsLoxHs198_05F [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 300-UTR3 COOR C/96758-97248 HITS SAIL_15_B09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN Exon COOR W/96880-97117,97365-97755 HITS SK12384 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-174 LOCN 300-UTR3 COOR W/97435-97751 NOTE CS1002164 HITS SK12642 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-179 LOCN 300-UTR3 COOR W/97435-97750 NOTE CS1002178 HITS SK12847 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-180 LOCN 300-UTR3 COOR W/97435-97753 NOTE CS1002201 HITS SK13034 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-180 LOCN 300-UTR3 COOR W/97435-97753 NOTE CS1002231 HITS SK13074 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-173 LOCN 300-UTR3 COOR W/97435-97741 NOTE CS1002234 HITS SK13141 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 300-UTR3 COOR W/97435-97755 NOTE CS1002249 HITS SK14027 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-180 LOCN 300-UTR3 COOR W/97435-97753 NOTE CS1002354 HITS SK14034 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-179 LOCN 300-UTR3 COOR W/97435-97750 NOTE CS1002356 HITS SK14503 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 300-UTR3 COOR W/97435-97756 NOTE CS1002370 HITS GABI_322D03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN 300-UTR3 COOR W/97457-97890 NOTE - - HITS SALKseq_030992.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/97459-97459 NOTE KO347598 Salk 10K 1:97458 TATTTCGGCGAGAACAAGGATTGTTTGTTTCTTTGGTTTAATTTTGTGTGCCCGTGAAAGACAACTTAATAACAAATTG HITS AY085212 [GenBank] TYPE Community cDNA EVAL 99.38 LOCN 300-UTR3 COOR W/97476-97805,98457-98605,98908-99237 HITS R09203 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 97.86 LOCN 300-UTR3 COOR W/97509-97805,98457-98605,98908-99239 NOTE AF360237