CODE AT1G01220.7 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01220.7 CDS ID=AT1G01220.7; Parent=AT1G01220; Name=AT1G01220.7; Note=L-fucokinase/GDP-L-fucose pyrophosphorylase; symbol=FKGP; Alias=AtFKGP, Arabidopsis thaliana L-fucokinase/GDP-L-fucose pyrophosphorylase; full_name=L-fucokinase/GDP-L-fucose pyrophosphorylase; Dbxref=PMID:15703057, PMID:17227549, PMID:18199744, locus:2035362; curator_summary=Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.; computational_description=L-fucokinase/GDP-L-fucose pyrophosphorylase (FKGP)%3B FUNCTIONS IN: fucose-1-phosphate guanylyltransferase activity%2C fucokinase activity%2C ATP binding%2C galactokinase activity%3B INVOLVED IN: GDP-L-fucose salvage%3B LOCATED IN: cytoplasm%3B EXPRESSED IN: 22 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Mevalonate/galactokinase (InterPro:IPR006206)%2C Ribosomal protein S5 domain 2-type fold (InterPro:IPR020568)%2C GHMP kinase (InterPro:IPR006204)%2C L-fucokinase (InterPro:IPR012887)%2C Ribosomal protein S5 domain 2-type fold%2C subgroup (InterPro:IPR014721)%2C GHMP kinase%2C C-terminal (InterPro:IPR013750)%3B Has 1878 Blast hits to 1819 proteins in 539 species: Archae - 59%3B Bacteria - 918%3B Metazoa - 155%3B Fungi - 3%3B Plants - 87%3B Viruses - 3%3B Other Eukaryotes - 653 (source: NCBI BLink).; locus_type=protein_coding COOR W/91750-92070,92270-92501,92569-92933,93045-93171,93271-94281,94357-95075,95160-95552 HITS GABI_938C10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 7e-80 LOCN 1000-Promotor COOR C/90536-90765 NOTE - - HITS FLAG_250G01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 300-UTR5 COOR C/91173-91546 HITS SAILseq_587_F04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/91386-91386 NOTE KO332976 SAIL 30K 1:91314 AAAAGCCCAAAGGCCCAAATATGAAAAGCTCGCTTATCTTTTATTGGCGTGCGGACTGAACTGATTGATGGATATATTGTGGTGTAAACAAATTG HITS GABI_060H05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-24 LOCN 1000-Promotor COOR W/91389-91452 NOTE - - HITS BX815033 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/91410-91632,91742-92067,92268-92936,93045-93171,93271-93406,94695-95076,95160-95631 HITS SALK_008654.43.35.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR5 COOR W/91657-92019 HITS RATM15-2829-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-118 LOCN Intron COOR W/92204-92480 HITS SALK_012400.56.00.x SALK T-DNA Homozygous Knockout Line for At1g01220 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Exon COOR C/92485-92894 NOTE At1g01220 HITS SALKseq_098443.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/93166-93166 NOTE KO436194 Salk 10K 1:93083 TTGTTAACAGTCTGGGGAGGCAAAAGATGTACAGCTACTGGTGATGTATTGACGCTTAGACAACTTAATTGGTATAGAT HITS SALK_037697.46.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-13 LOCN Intron COOR W/93204-93241 HITS SALK_037697.46.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-07 LOCN Intron COOR W/93216-93241 HITS GABIseq_094A04.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/93325-93325 NOTE KG781170 GABI 10K 1:93303 AGATGATTTGCAGTTTTTGCATTTTGGAACATCAAGTGAGGTATTGGATCATTTAAGAAATCTACAACACTGAAACACTGATCAATTGTAAATGGCTTCA HITS GABIseq_094A04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/93340-93340 NOTE KG781169 GABI 10K 1:93300 ATATCAGAAACCGTAGTTGCAGGGATGGAACATAAGTGTCTCCGACCAACAATTCAGGTATTGACCATCATACATGGCTTCATATTCAATTGTAAATGGC HITS SALKseq_048836.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/93467-93467 NOTE KO402006 Salk 20K 1:93298 TATTTTGTCTAGTGAAATTGCACCTGGTGTCTCCATTGGTGAAGATTCACTTATATATAACAAATTGACGCTTAGACAA HITS SALK_053913.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Intron COOR C/93945-94347 HITS SALK_013281.17.05.x SALK T-DNA Homozygous Knockout Line for At1g01220 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-47 LOCN Exon COOR C/93995-94234 NOTE At1g01220 HITS SALK_013281.29.99.f SALK T-DNA Homozygous Knockout Line for At1g01220 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 1e-47 LOCN Exon COOR C/93995-94234 NOTE At1g01220 HITS SALKseq_123458.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/94026-94026 NOTE KO366759 Salk 60K 1:94027 ATCAAGCTGATCTTGCGGGTGGAATCGCTAAAGCATGTATGAACTATGGTATGCTTGGGCAAACAAATTGACGCTTAGA HITS SALKseq_053913.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/94348-94348 NOTE KO352035 Salk 30K 1:94201 TTAGAGGTAAAAATCTAGCCACCACCGTTTGGTATAACACCTTTCATAAACCTGGATTTAACTCTTTTATTTGCAGGATATATTGTGGTGTAAAC HITS SK38337 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN Exon COOR W/94538-94993 NOTE CS1014542 HITS SALKseq_050910.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/94945-94945 NOTE KO348544 Salk 30K 1:94944 AAAGGAACAACTTGAAGACGCATAGGGATTCCTGGAAAACTTGAAGTGAATTTGATTCCTGGATATATTGTGGTGTAA HITS CSHL_GT14967 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 300-UTR3 COOR C/95118-95829 HITS GABI_151E09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-75 LOCN Exon COOR C/95166-95346 NOTE - - HITS SAILseq_897_G01.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/95186-95186 NOTE KO329964 SAIL 40K 1:95243 TCGCCAGCTCCGTCAATCGCTTAATGCTTGAAATTAGGAGATTATCTCTTTGCAAATACCTTGTAACGACCTTGATATTGTGGTGTAAACAAATTAACGC HITS SALK_050563.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-147 LOCN 300-UTR3 COOR C/95320-95622 HITS SALK_050582.55.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR3 COOR C/95321-95725 HITS Wiscseq_DsLox386F09.4 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/95630-95630 NOTE KG802399 Wisc 10K 1:95604 TACAGTGTCAGTGTGTCATCATCTTGATTCTTGTAAATTGATATATTTTTTTGGGACCTTTGGAAAAAATTAATAACACATTGACGCTTAGACGACTTAA HITS SAIL_287_A04 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR3 COOR W/95723-96507 HITS CSHL_GT14967 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 300-UTR3 COOR W/95822-96561