CODE AT1G01210.3 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01210.3 CDS ID=AT1G01210.3; Parent=AT1G01210; Name=AT1G01210.3; Note=DNA-directed RNA polymerase%2C subunit M%2C archaeal; Dbxref=PMID:17447913, locus:2035322; computational_description=DNA-directed RNA polymerase%2C subunit M%2C archaeal%3B FUNCTIONS IN: in 6 functions%3B INVOLVED IN: RNA elongation%2C regulation of transcription%2C DNA-dependent%2C transcription%2C regulation of transcription%3B LOCATED IN: nucleus%3B CONTAINS InterPro DOMAIN/s: Zinc finger%2C TFIIS-type (InterPro:IPR001222)%2C DNA-directed RNA polymerase%2C M/15kDa subunit (InterPro:IPR001529)%2C DNA-directed RNA polymerase%2C subunit M%2C archaeal (InterPro:IPR006288)%2C DNA-directed RNA polymerase M%2C 15kDa subunit%2C conserved site (InterPro:IPR019761)%3B BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase%2C subunit M%2C archaeal (TAIR:AT4G07950.1)%3B Has 1129 Blast hits to 1129 proteins in 326 species: Archae - 242%3B Bacteria - 0%3B Metazoa - 276%3B Fungi - 294%3B Plants - 112%3B Viruses - 0%3B Other Eukaryotes - 205 (source: NCBI BLink).; locus_type=protein_coding COOR W/88977-89081,89173-89263,89405-89529 HITS SAIL_568_G09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR C/87950-88663 HITS ET_5_1418 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 1e-32 LOCN 1000-Promotor COOR W/88021-88102 NOTE CS181991 HITS SAIL_883_G07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR5 COOR C/88321-88785 HITS SK32415 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 300-UTR5 COOR C/88355-88938 NOTE CS1011528 HITS GABI_038E02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-68 LOCN 300-UTR5 COOR C/88509-88687 NOTE - - HITS SAILseq_554_F11.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/88782-88782 NOTE KO329325 SAIL 30K 1:88849 AATACTTTAATTGTTTCACCCCAACTTTTATTGGGCCTAAAATATCACGTAGGCCCAACTTATGCTACAATCCATATATTTAATTTTTCAGCAAC HITS SALKseq_54437.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/88832-88832 NOTE KO444691 Salk 60K 1:88834 GTTACGAAATACTTTAATTGTTTCACCCCAACTTTTATTGGGCCTAAAAGTATATTTAATGAAACAAATTGACGCTTAG HITS SALK_146765.29.90.n [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR5 COOR W/88835-89283 HITS RAFL17-25-D24 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 97.31 LOCN Exon COOR W/88898-89081,89173-89263,89405-89743 HITS RAFL17-25-D24 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.24 LOCN Exon COOR W/88898-89081,89173-89263,89405-89743 HITS R50415 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 97.31 LOCN Exon COOR W/88898-89081,89173-89263,89405-89743 NOTE BT008671 HITS BX818201 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/88911-89083,89175-89261,89403-89754 HITS BX836933 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/88925-89083,89175-89261,89403-89866,89954-89990 HITS BX813659 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/88931-89083,89175-89261,89403-90507 HITS WiscDsLoxHs173_02E [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 3e-29 LOCN 300-UTR5 COOR W/88956-89081 HITS Wiscseq_DsLoxHs095_01B.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/88971-88971 NOTE KG814601 Wisc 20K 1:88989 GTGGAACAGAAGAATCTCGAATTGCCACCTCCCTCGTATCGCAACAGATTCCCACATGTTGGACAAAACTCCATCTTCCA HITS U50415 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR W/88977-89081,89173-89263,89405-89560 NOTE BT008558 HITS G50415 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR W/88977-89081,89173-89263,89405-89560 NOTE U50415 BT008558 pENTR_Sfi HITS BX817667 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/88979-89083,89175-89261,89403-89848 HITS WiscDsLoxHs095_01A Wisc T-DNA Homozygous Knockout Line for At1g01210 by Salk
[Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc T-DNA HM EVAL 8e-27 LOCN Exon COOR W/89007-89075 NOTE At1g01210 HITS SALKseq_47981.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/89276-89276 NOTE KO444167 Salk 50K 1:89279 GGTTAAGAAATCTATAGAAGCTGTTGTGACTAAAGATGATATACCCACAGCTGCTGAAACTGAAGGTATTTTCAGTCT HITS RAFL17-25-D24 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR W/89403-89743 HITS BX834170 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 300-UTR3 COOR C/89801-90579