CODE AT1G01200.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01200.1 CDS ID=AT1G01200.1; Parent=AT1G01200; Name=AT1G01200.1; Note=RAB GTPase homolog A3; conf_class=1; symbol=RABA3; Alias=ATRAB-A3, ARABIDOPSIS RAB GTPASE HOMOLOG A3, ATRABA3, RAB GTPase homolog A3; full_name=RAB GTPase homolog A3; computational_description=RAB GTPase homolog A3 (RABA3)%3B FUNCTIONS IN: GTP binding%3B INVOLVED IN: protein transport%2C small GTPase mediated signal transduction%3B LOCATED IN: endosome%2C nucleus%2C cell plate%3B EXPRESSED IN: lateral root cap%2C hypocotyl%2C root%2C flower%2C epidermis%3B EXPRESSED DURING: petal differentiation and expansion stage%3B CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806)%2C Small GTP-binding protein (InterPro:IPR005225)%2C Small GTPase (InterPro:IPR020851)%2C Ras (InterPro:IPR013753)%2C Ras small GTPase%2C Rab type (InterPro:IPR003579)%2C Rab11-related (InterPro:IPR015595)%3B BEST Arabidopsis thaliana protein match is: RAB GTPase homolog A4C (TAIR:AT5G47960.1)%3B Has 27164 Blast hits to 27137 proteins in 734 species: Archae - 19%3B Bacteria - 134%3B Metazoa - 14292%3B Fungi - 3779%3B Plants - 3194%3B Viruses - 20%3B Other Eukaryotes - 5726 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12644670, PMID:15703057, PMID:16581873, PMID:18239134, locus:2035302; locus_type=protein_coding COOR C/86715-87162,87880-88145 HITS FLAG_520D01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-162 LOCN Exon COOR C/86437-86765 HITS FLAG_557D11 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-162 LOCN Exon COOR C/86437-86765 HITS GABI_292D07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-130 LOCN Exon COOR C/86459-86724 NOTE - - HITS SALKseq_085489.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/86488-86488 NOTE KO428179 Salk 70K 1:86489 TTGATAAAACTCTAGTTTTTACTTAACATTTTGATTGAATAGTGGTGTAATCATGTTCAGGATACATTGTGGTGTAAAC HITS RAFL14-75-F22 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/86516-86925,86933-86964 HITS S63447 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk cDNA EVAL 100.00 LOCN Exon COOR C/86550-87162,87880-88210 NOTE BT010707 HITS SAIL_291_G02 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 7e-28 LOCN 300-UTR3 COOR C/86573-86640 HITS SAILseq_291_G02.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/86650-86650 NOTE KO324287 SAIL 30K 1:86688 CATAAAATCAAAAGCCAATTATTGGGCCTTTCTTTAAGCCCATATATGTGTAAACAAATTGACGCTTAGACAACTTAATGCTGCTAGATCGGACG HITS SAILseq_900_B10.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/86700-86700 NOTE KO337918 SAIL 40K 1:86675 CAAATATGGGCTTAAAGAAAGGCCCAATAATTGGCTTTTGATTTTATGGCCCAATAATTTCGCCAGGATAAATTGTGGTGTAAACAAATAGACACTTAGA HITS C63447 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk pUni Clone EVAL 100.00 LOCN Exon COOR C/86715-87162,87880-88145 NOTE BT010979 HITS GC63447 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/86715-87162,87880-88145 NOTE C63447 BT010979 pENTR_Sfi HITS SALK_148433.55.00.x SALK T-DNA Homozygous Knockout Line for At1g01200 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-110 LOCN Exon COOR W/86753-86953 NOTE At1g01200 HITS SAIL_182_E09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN Intron COOR C/86775-87347 HITS SALK_001237.29.99.f [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 4e-87 LOCN Intron COOR C/86949-87170 HITS SALK_016272.54.50.x SALK T-DNA Homozygous Knockout Line for At1g01200 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Intron COOR C/86968-87354 NOTE At1g01200 HITS SALK_001323.16.90.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-15 LOCN Intron COOR C/87015-87192 HITS SALK_001229.53.00.x SALK T-DNA Homozygous Knockout Line for At1g01200 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-69 LOCN Intron COOR W/87277-87412 NOTE At1g01200 HITS SM_3_20130 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Intron COOR C/87308-87718 NOTE CS105597 HITS SALK_094687.56.00.x SALK T-DNA Homozygous Knockout Line for At1g01200 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN Intron COOR C/87409-87730 NOTE At1g01200 HITS WiscDsLoxHs187_08A [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL e-103 LOCN Intron COOR W/87479-87654,87873-88062 HITS Wiscseq_DsLox481-484K22.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/87603-87603 NOTE KG807928 Wisc 10K 1:87575 AAGTATGCAACAAAGTATTCGGTGAGTTATTGCATTTGACCTTTTGATCTATAAGTGGTTGCAAAGACAAATTGCGGACAACTTAATAACACATTGCGGA HITS WiscDsLox481-484K22 Wisc T-DNA Homozygous Knockout Line for At1g01200 by Salk
[Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc T-DNA HM EVAL 0.0 LOCN Intron COOR W/87613-88364 NOTE At1g01200 HITS SM_3_36663 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Exon COOR C/87615-88034 NOTE CS123374 HITS SAIL_548_B07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR5 COOR C/87779-88314 HITS ET_5_1198 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 8e-18 LOCN Exon COOR C/87842-87887 NOTE CS181771 HITS SM_3_36289 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 2e-62 LOCN Exon COOR W/87911-88030 NOTE CS123000 HITS SAIL_568_G09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR C/87950-88663 HITS ET_5_1418 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 1e-32 LOCN Exon COOR W/88021-88102 NOTE CS181991 HITS SAIL_883_G07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR C/88321-88785 HITS SK32415 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR C/88355-88938 NOTE CS1011528 HITS GABI_038E02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-68 LOCN 1000-Promotor COOR C/88509-88687 NOTE - - HITS SAILseq_554_F11.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/88782-88782 NOTE KO329325 SAIL 30K 1:88849 AATACTTTAATTGTTTCACCCCAACTTTTATTGGGCCTAAAATATCACGTAGGCCCAACTTATGCTACAATCCATATATTTAATTTTTCAGCAAC HITS SALKseq_54437.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/88832-88832 NOTE KO444691 Salk 60K 1:88834 GTTACGAAATACTTTAATTGTTTCACCCCAACTTTTATTGGGCCTAAAAGTATATTTAATGAAACAAATTGACGCTTAG HITS SALK_146765.29.90.n [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/88835-89283 HITS RAFL17-25-D24 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 97.31 LOCN 1000-Promotor COOR W/88898-89081,89173-89263,89405-89743 HITS RAFL17-25-D24 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.24 LOCN 1000-Promotor COOR W/88898-89081,89173-89263,89405-89743 HITS R50415 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 97.31 LOCN 1000-Promotor COOR W/88898-89081,89173-89263,89405-89743 NOTE BT008671 HITS BX818201 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR W/88911-89083,89175-89261,89403-89754 HITS BX836933 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR W/88925-89083,89175-89261,89403-89866,89954-89990 HITS BX813659 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR W/88931-89083,89175-89261,89403-90507 HITS WiscDsLoxHs173_02E [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 3e-29 LOCN 1000-Promotor COOR W/88956-89081 HITS Wiscseq_DsLoxHs095_01B.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/88971-88971 NOTE KG814601 Wisc 20K 1:88989 GTGGAACAGAAGAATCTCGAATTGCCACCTCCCTCGTATCGCAACAGATTCCCACATGTTGGACAAAACTCCATCTTCCA HITS U50415 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN 1000-Promotor COOR W/88977-89081,89173-89263,89405-89560 NOTE BT008558 HITS G50415 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN 1000-Promotor COOR W/88977-89081,89173-89263,89405-89560 NOTE U50415 BT008558 pENTR_Sfi HITS BX817667 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR W/88979-89083,89175-89261,89403-89848 HITS WiscDsLoxHs095_01A Wisc T-DNA Homozygous Knockout Line for At1g01210 by Salk
[Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc T-DNA HM EVAL 8e-27 LOCN 1000-Promotor COOR W/89007-89075 NOTE At1g01210