CODE AT1G01190.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01190.2 CDS ID=AT1G01190.2; Parent=AT1G01190; Name=AT1G01190.2; Note=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; symbol=CYP78A8; full_name=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8; curator_summary=member of CYP78A; computational_description=cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 8 (CYP78A8)%3B FUNCTIONS IN: electron carrier activity%2C monooxygenase activity%2C iron ion binding%2C oxygen binding%2C heme binding%3B INVOLVED IN: oxidation reduction%3B LOCATED IN: endomembrane system%3B EXPRESSED IN: 6 plant structures%3B EXPRESSED DURING: LP.10 ten leaves visible%2C LP.02 two leaves visible%2C LP.12 twelve leaves visible%3B CONTAINS InterPro DOMAIN/s: Cytochrome P450 (InterPro:IPR001128)%2C Cytochrome P450%2C conserved site (InterPro:IPR017972)%2C Cytochrome P450%2C E-class%2C group I (InterPro:IPR002401)%3B BEST Arabidopsis thaliana protein match is: cytochrome P450%2C family 78%2C subfamily A%2C polypeptide 6 (TAIR:AT2G46660.1)%3B Has 32104 Blast hits to 32001 proteins in 1725 species: Archae - 48%3B Bacteria - 3617%3B Metazoa - 11430%3B Fungi - 6777%3B Plants - 9112%3B Viruses - 3%3B Other Eukaryotes - 1117 (source: NCBI BLink).; Dbxref=PMID:15280363, PMID:15546358, PMID:15703057, PMID:16520461, PMID:15604721, PMID:18650403, PMID:20736450, PMID:23610218, PMID:23733073, locus:2035282; locus_type=protein_coding COOR C/83045-83671,83884-84879 HITS BX836077 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/82901-83385 HITS SALKseq_065752.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/82921-82921 NOTE KO399548 Salk 40K 1:82923 CTAGCGAAGTAGATTCGCCCACCTTTTATTATTGAAGCTTATTAGAATATATTGTGGTGTAAACAAATTGACGCTTAG HITS GABI_071A03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 5e-48 LOCN Exon COOR C/82961-83056 NOTE - - HITS SALKseq_139042.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/83040-83040 NOTE KO374210 Salk 10K 1:83048 TGAGATGGCTTGTCCACTCATCGTTAACGTAAGCTCAAGGCGTAAGATAATTAAACTGTTAAACAAATTGACGCTTAGA HITS GABI_071A03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-14 LOCN Exon COOR W/83112-83150 NOTE - - HITS SK35326 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN Exon COOR W/83231-83822 NOTE CS1013015 HITS RATM13-0518-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 2e-16 LOCN Exon COOR W/83297-83338 HITS RATM11-2463-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR C/83335-83977 HITS GABI_243G01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-111 LOCN Exon COOR W/83369-83574 NOTE - - HITS SK31623 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 3e-20 LOCN Intron COOR C/83603-83740 NOTE CS1011075 HITS SAIL_261_A06 SAIL T-DNA Homozygous Knockout Line for At1g01190
[Seq] [SAIL HM Collection by Salk] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM EVAL 0.0 LOCN Intron COOR W/83740-84300 NOTE At1g01190 HITS GABI_215E04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-70 LOCN Intron COOR W/83820-83961 NOTE - - HITS SM_3_1269 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Exon COOR W/83900-84325 NOTE CS56924 HITS SM_3_35299 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Exon COOR W/83907-84352 NOTE CS122010 HITS SALKseq_055399.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/83907-83907 NOTE KO342060 Salk 50K 1:83801 ATAGTGATTAAAAGACAAAACTTACCCAAAGAACAGCAACCATGTCGGACGCTTAGACAACTTAATTGGTATAGATCG HITS SM_3_38232 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Exon COOR W/83937-84336 NOTE CS124943 HITS GABI_351H07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-128 LOCN Exon COOR C/84098-84408 NOTE - - HITS GABI_393B01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-176 LOCN Exon COOR C/84100-84410 NOTE - - HITS SAIL_555_E03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-100 LOCN Exon COOR W/84116-84308 HITS SAIL_555_G03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-102 LOCN Exon COOR W/84116-84303 HITS SM_3_233 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Exon COOR C/84125-84595 NOTE CS56400 HITS SK23334 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 8e-61 LOCN Exon COOR W/84182-84303 NOTE CS1006628 HITS SK23345 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 3e-63 LOCN Exon COOR W/84182-84303 NOTE CS1006635 HITS SK23350 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 6e-61 LOCN Exon COOR W/84182-84303 NOTE CS1006639 HITS GABI_793D09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-75 LOCN Exon COOR C/84193-84342 NOTE - - HITS SK23348 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 7e-37 LOCN Exon COOR W/84222-84303 NOTE CS1006637 HITS SAIL_98_C06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-24 LOCN Exon COOR W/84248-84305 HITS SAIL_98_D06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 4e-26 LOCN Exon COOR W/84248-84308 HITS SAIL_98_D06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 6e-22 LOCN Exon COOR W/84248-84309 HITS SM_3_33985 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 5e-76 LOCN Exon COOR W/84398-84540 NOTE CS120696 HITS SM_3_33987 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 5e-73 LOCN Exon COOR W/84398-84535 NOTE CS120698 HITS SM_3_33992 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 2e-43 LOCN Exon COOR W/84398-84485 NOTE CS120703 HITS SM_3_34023 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 7e-88 LOCN Exon COOR W/84398-84560 NOTE CS120734 HITS GABIseq_096F06.4 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/84446-84446 NOTE KG781209 GABI 10K 1:84517 CTCGGTGATACTAAGGTGGTGGTGACGTGTCATCCTGCCGTGGCAAAGGAGATACTAAACAGTTAGGTTTTTGATGAAACCATATATTCAATTGTAAATG HITS GABI_200A02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-51 LOCN Exon COOR W/84489-84610 NOTE - - HITS GABI_200D02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 6e-63 LOCN Exon COOR W/84501-84629 NOTE - - HITS GABI_100H01 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 2e-17 LOCN Exon COOR W/84584-84631 NOTE at1g01190 CS409589 HITS SK35391 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR C/84687-85282 NOTE CS1013057 HITS SALKseq_064273.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/84738-84738 NOTE KO365989 Salk 50K 1:84737 CAACATTTTGCTTCCCTTCTCGTCGCCATTGCTATCACTTGGTTTACCATAACCATCGTATATATTGTGGTGTAAACA HITS SM_3_16495 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN 300-UTR5 COOR C/84815-85136 NOTE CS104280 HITS SALKseq_139264.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/84882-84882 NOTE KO387615 Salk 40K 1:84881 AAGAAGAAGAAGAACATTTATCCTATCCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATTCTGC