CODE AT1G01180.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01180.1 CDS ID=AT1G01180.1; Parent=AT1G01180; Name=AT1G01180.1; Note=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; conf_class=1; computational_description=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein%3B FUNCTIONS IN: methyltransferase activity%3B INVOLVED IN: lipid biosynthetic process%3B EXPRESSED IN: sperm cell%2C hypocotyl%3B CONTAINS InterPro DOMAIN/s: Rhamnosyl O-methyltransferase/Cephalosporin hydroxylase (InterPro:IPR007072)%3B Has 274 Blast hits to 274 proteins in 51 species: Archae - 0%3B Bacteria - 75%3B Metazoa - 2%3B Fungi - 0%3B Plants - 46%3B Viruses - 0%3B Other Eukaryotes - 151 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12101121, PMID:15703057, PMID:16520461, locus:2035262; locus_type=protein_coding COOR W/75633-76556 HITS GABI_460E09 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-104 LOCN 1000-Promotor COOR C/74566-74767 NOTE - - HITS FLAG_457A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 1e-44 LOCN 1000-Promotor COOR W/74672-74761 HITS SALK_073411.49.55.x SALK T-DNA Homozygous Knockout Line for At1g01170 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-15 LOCN 1000-Promotor COOR C/74714-74754 NOTE At1g01170 HITS SALK_005093.42.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-44 LOCN 1000-Promotor COOR C/74714-74802 HITS SALK_066235.47.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-42 LOCN 1000-Promotor COOR C/74714-74799 HITS SALK_005101.26.45.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-06 LOCN 1000-Promotor COOR C/74726-74783 HITS SAIL_885_F09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 300-UTR5 COOR C/74731-75364 HITS FLAG_205A11 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 1000-Promotor COOR C/74761-75208 HITS FLAG_232H07 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 1000-Promotor COOR C/74762-75208 HITS FLAG_431F07 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-107 LOCN 1000-Promotor COOR C/74762-74956 HITS SALKseq_48933.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/74773-74773 NOTE KO450284 Salk 50K 1:74780 GTCATGATTGTAGTTTTGTCTCTTAATAAAACTAGTAATTAACGTTTCAGAAAACAATGCCCATTTTGGTAATTTCTCAGGATATATTGTGGTGTATACA HITS Wiscseq_DsLox350B02.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/74877-74877 NOTE KG800248 Wisc 10K 1:74932 TCTCTGTGAAATTACCAAAATGGGCATTGTTTTCTGAAACGTTAATTACTAGTTTTATTAAGAGACAAAACTACAATCATCACAAGGGAAGATATAATAG HITS FLAG_480C01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 2e-15 LOCN 1000-Promotor COOR W/74963-75016 HITS GABI_355C12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-73 LOCN 1000-Promotor COOR W/75149-75291 NOTE - - HITS GABI_102G11 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN Exon COOR C/75414-75926 NOTE at1g01180 CS409779 HITS Wiscseq_DsLox436B10.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/75456-75456 NOTE KG804869 Wisc 10K 1:75434 ATTTTGATTGTAAATGACTACATCACATGTAGCTTTCTAGACACGTAAAGTCAAATAAATACAAATAAATTAGATCACATGCGGACAACTTAATAACACA HITS RAFL14-83-E11 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.00 LOCN Exon COOR W/75602-75970,76024-76647 HITS BX815707 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/75649-76654 HITS FLAG_584H02 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 1e-12 LOCN Exon COOR C/75661-75733 HITS GABI_102G11 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN Exon COOR W/75931-76405 NOTE at1g01180 CS409779 HITS GT_5_100759 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 2e-72 LOCN Exon COOR C/75983-76119 NOTE CS164573 HITS GABIseq_535A12.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/76059-76059 NOTE KG787536 GABI 10K 1:76032 AAGAATCAAAGGTTGGGGATCATACGGGGCCGTTTTCGAGAATCTAATCCGCCGAGTCAAACCTAAGACGATCGTCGAAGTCAGGATATATTCAATTGTA HITS GABI_102H12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-123 LOCN Exon COOR W/76181-76569 NOTE - - HITS RAFL14-83-E11 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR W/76210-76636 HITS Wiscseq_DsLox242H01.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/76563-76563 NOTE KG796357 Wisc 10K 1:76541 CTGTTCGCAGAGATTAACCGGTTAAAGGTCAAAACCGATGGTCAACATTGGGTTATTGATTCGGTCAAAGTAACCTGATTCCCTTAATAACACATTGCGG HITS GABI_363E08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-141 LOCN 300-UTR3 COOR W/76584-76896 NOTE - - HITS WiscDsLox242H01 Wisc T-DNA Homozygous Knockout Line for At1g01180 by Salk
[Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc T-DNA HM EVAL 0.0 LOCN 300-UTR3 COOR W/76610-77058 NOTE At1g01180 HITS Wiscseq_DsLoxHs051_12F.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/76713-76713 NOTE KG812593 Wisc 20K 1:76713 ATATTTTTTTTCCATCTTTTGAAAATTAATGGATTTGAGGTTTTTGATTGTGTAATGAGAAAAAATATTTGATTGATCAG