CODE AT1G01150.3 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01150.3 CDS ID=AT1G01150.3; Parent=AT1G01150; Name=AT1G01150.3; Note=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein; computational_description=Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain%3B FUNCTIONS IN: DNA binding%2C zinc ion binding%3B INVOLVED IN: regulation of transcription%3B EXPRESSED IN: 8 plant structures%3B EXPRESSED DURING: 4 anthesis%2C petal differentiation and expansion stage%2C E expanded cotyledon stage%2C D bilateral stage%3B CONTAINS InterPro DOMAIN/s: Homeodomain-like (InterPro:IPR009057)%2C Zinc finger%2C PHD-type%2C conserved site (InterPro:IPR019786)%2C Zinc finger%2C FYVE/PHD-type (InterPro:IPR011011)%2C Homeodomain-related (InterPro:IPR012287)%2C MYB-like (InterPro:IPR017877)%3B BEST Arabidopsis thaliana protein match is: TRF-like 10 (TAIR:AT5G03780.1)%3B Has 94 Blast hits to 77 proteins in 18 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 5%3B Fungi - 0%3B Plants - 86%3B Viruses - 0%3B Other Eukaryotes - 3 (source: NCBI BLink).; Dbxref=PMID:15703057, PMID:16481336, locus:2035372; locus_type=protein_coding COOR C/70828-70968,71041-71721,71942-71998 HITS Wiscseq_DsLoxHs090_02G.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/70740-70740 NOTE KO452634 Wisc 20K 1:70753 ACCATAAAATCCTTAGAAGTATTAAATGACGCATTTGATATCAAAAACATTAAGACAAATCCTAGTGACCTTTTGAATTG HITS WiscDsLoxHs090_02G [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 300-UTR3 COOR W/70747-71309 HITS CSHL_GT17974 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR W/70953-71296 HITS RATM11-1476-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-132 LOCN Exon COOR C/71107-71343 HITS SALKseq_044655.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/71218-71218 NOTE KO385059 Salk 20K 1:71217 AGAAAACAGTCAACTAGAGAATGGTTCTGATAATTCACTACCAATGCAACTACATCAATAACAGGATATATTGTGGTGT HITS SALK_044655.30.80.x SALK T-DNA Homozygous Knockout Line for At1g01150 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-129 LOCN Exon COOR W/71225-71545 NOTE At1g01150 HITS CSHL_GT20526 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-134 LOCN Exon COOR W/71327-71571 HITS RATM11-1476-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL e-117 LOCN Exon COOR W/71335-71547 HITS WiscDsLox402G12 Wisc T-DNA Homozygous Knockout Line for At1g01160 by Salk
[Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc T-DNA HM EVAL 0.0 LOCN 1000-Promotor COOR C/71530-72550 NOTE At1g01160 HITS RATM11-0994-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 300-UTR5 COOR C/71544-72156 HITS SALK_021888.55.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR5 COOR C/71629-72075 HITS SALK_011744.17.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-86 LOCN Exon COOR C/71729-71989 HITS SK13129 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-168 LOCN 300-UTR5 COOR C/71734-72040 NOTE CS1002243 HITS SALK_025802.32.95.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR5 COOR C/71832-72260 HITS SALKseq_036978.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/72077-72077 NOTE KO381323 Salk 20K 1:71981 AAGTTTTGAGAAATTCGAAGGCTTTACGTGAGATTTCTTAACGAATAAGAAAAAGAAGCGTCAGGATATATTGTGGTGT HITS GABIseq_376F07.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/72124-72124 NOTE KG784401 GABI 10K 1:72170 GGACCATCGAGAAAGTTACATTGCAAAGTACTACATTGAGTCAGTTTCTTCCTTCTTCGCCTAAATTCGAAATTTCGCCGAATATATTCAATTGTAAATG HITS RATM11-0994-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 300-UTR5 COOR W/72150-72798 HITS SALKseq_087099.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/72304-72304 NOTE KO435100 Salk 80K 1:72224 CCATTGGCCCAAATATATCCAAAACTTTCTAATTTGGTTAGAGGTTGCTCGTTGCTGTATTGTGGTGTAAACAAATTG HITS SALKseq_032830.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/72349-72349 NOTE KO361047 Salk 10K 1:72205 ATTTGGTTAGAGGTTGCTCGTTGCTGTATTAATTAATGTTTTATGTTTTCGTTTAGAGTTTTGTAAACAAATTGACGCT HITS BX841803 [GenBank] [Order] TYPE GSLT cDNA EVAL e-172 LOCN 1000-Promotor COOR W/72357-72669,73087-73163,73287-73393,73486-73741,73822-74096 HITS RAFL04-13-H03 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN 1000-Promotor COOR C/72376-72844 HITS AY102640 [GenBank] TYPE Community cDNA EVAL 98.56 LOCN 1000-Promotor COOR W/72379-72669,73087-73163,73287-73395,73488-73740,73822-74050 HITS RAFL06-13-G16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-136 LOCN 1000-Promotor COOR C/72418-72669,73087-73163,73287-73393,73486-73718 HITS R13413 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.89 LOCN 1000-Promotor COOR W/72419-72669,73087-73163,73287-73395,73488-73740,73822-74046 NOTE AF410307 HITS BX835419 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR W/72431-73401 HITS U13413 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN 1000-Promotor COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 NOTE AY102133 HITS G13413 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN 1000-Promotor COOR W/72583-72669,73087-73163,73287-73395,73488-73740,73822-73883 NOTE U13413 AY102133 pENTR_Sfi