CODE AT1G01140.3 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01140.3 CDS ID=AT1G01140.3; Parent=AT1G01140; Name=AT1G01140.3; Note=CBL-interacting protein kinase 9; curator_summary=Encodes a CBL-interacting protein kinase with similarity to SOS2; conf_class=2; symbol=CIPK9; Alias=PKS6, PROTEIN KINASE 6, SnRK3.12, SNF1-RELATED PROTEIN KINASE 3.12; full_name=CBL-interacting protein kinase 9; computational_description=CBL-interacting protein kinase 9 (CIPK9)%3B FUNCTIONS IN: protein serine/threonine kinase activity%2C protein kinase activity%2C kinase activity%2C ATP binding%3B INVOLVED IN: in 6 processes%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein kinase%2C ATP binding site (InterPro:IPR017441)%2C NAF/FISL domain (InterPro:IPR018451)%2C Serine/threonine-protein kinase domain (InterPro:IPR002290)%2C Serine/threonine-protein kinase-like domain (InterPro:IPR017442)%2C Protein kinase-like domain (InterPro:IPR011009)%2C Serine/threonine-protein kinase%2C active site (InterPro:IPR008271)%2C CBL-interacting protein kinase (InterPro:IPR020660)%2C NAF domain (InterPro:IPR004041)%2C Protein kinase%2C catalytic domain (InterPro:IPR000719)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%2C Tyrosine-protein kinase%2C catalytic domain (InterPro:IPR020635)%3B BEST Arabidopsis thaliana protein match is: CBL-interacting protein kinase 23 (TAIR:AT1G30270.1)%3B Has 130203 Blast hits to 128118 proteins in 4349 species: Archae - 165%3B Bacteria - 15262%3B Metazoa - 47961%3B Fungi - 13206%3B Plants - 31482%3B Viruses - 522%3B Other Eukaryotes - 21605 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11230129, PMID:12805596, PMID:12045290, PMID:14730064, PMID:15574398, PMID:15703057, PMID:16146321, PMID:16214899, PMID:16673935, PMID:17397506, PMID:17551672, PMID:18650403, PMID:18775970, PMID:17486125, PMID:20870959, PMID:21477822, PMID:23109687, PMID:25614064, PMID:25646412, locus:2035367; locus_type=protein_coding COOR C/64398-64475,64570-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS SAIL_547_A03 SAIL T-DNA Homozygous Knockout Line for At1g01130
[Seq] [SAIL HM Collection by Salk] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM EVAL 5e-16 LOCN 300-UTR3 COOR W/64123-64254 NOTE At1g01130 HITS RAFL09-20-N24 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-149 LOCN Exon COOR C/64171-64477,64584-64656 HITS RAFL04-16-A16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-166 LOCN Exon COOR C/64182-64477,64584-64658,64753-64807,64901-65018,65111-65219,65333-65385 HITS R15436 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.82 LOCN Exon COOR C/64182-64383,64382-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67619 NOTE AF386999 HITS FLAG_551A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 300-UTR3 COOR W/64182-64508 HITS BX817129 [GenBank] [Order] TYPE GSLT cDNA EVAL e-158 LOCN Exon COOR C/64201-64477,64583-64658,64753-64807,64901-65018,65111-65216,65329-65456,65563-65652,65739-65866,66109-66159,66261-66342,66450-66557,66678-66751,66837-66897,67324-67606 HITS CSHL_GT24842 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/64209-64917 HITS CSHL_GT24847 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/64218-64917 HITS U15436 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP Gateway Clone EVAL 99.93 LOCN Exon COOR C/64290-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 NOTE U15436 AY093242 pENTR-TOPO HITS SALKseq_132704.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/64364-64364 NOTE KO397330 Salk 20K 1:64235 CCAACTCCAGAATGTTTACTATTCATTATACATGTTCAACATTGACGCTTAGACAACTTAATACACTGAGATCGGAAGA HITS Wiscseq_DsLox433A3.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/64378-64378 NOTE KG804642 Wisc 10K 1:64356 CAGCAATACTTGTATATTGCCAACTCCAGAATGTTTACTATTCATTATACATGTTCAACATTGATTAAAAACTTTGAAAATTCAGGATCTATTGTGGTGT HITS SALK_132704.46.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 300-UTR3 COOR W/64389-64810 HITS AF295664 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR C/64398-64475,64582-64653,64748-64807,64901-65017,65110-65217,65331-65456,65563-65652,65733-65858,66100-66160,66262-66342,66450-66557,66678-66746,66832-66897,67324-67512 HITS AF339147 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR C/64398-64475,64570-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS SALK_133449.29.60.n SALK T-DNA Homozygous Knockout Line for At1g01140 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-154 LOCN Exon COOR W/64457-64811 NOTE At1g01140 HITS SALKseq_138377.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/64464-64464 NOTE KO364130 Salk 80K 1:64461 CTGCATCAGTATTCCAGACTACATCCTTTAATCCAGATGAAAAGGATATATTGTGGTGTAAACAAATTGACGCTTAGA HITS FLAG_070B10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-105 LOCN Intron COOR C/64508-64700 HITS FLAG_070H08 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-105 LOCN Intron COOR C/64508-64700 HITS FLAG_071F01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-105 LOCN Intron COOR C/64508-64700 HITS SALKseq_129041.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/64516-64516 NOTE KO387136 Salk 70K 1:64463 CAGATGAGAAGTTTTTGTAGAACTGCAAAAGAGATTCAAACATAAAACCAATTTAAACACTAACAAATTGACGCTTAGA HITS SALKseq_081549.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR W/64518-64518 NOTE KO424119 Salk 70K 1:64236 CGGTTCGGTTTTGATCCGGTTAACATCTCTAGCAAATAACAAGAAGAATTAAGCGCCAATATATTGTGGTGTAAACAAA HITS SALK_014699.34.20.x SALK T-DNA Homozygous Knockout Line for At1g01140 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-145 LOCN Intron COOR W/64828-65218 NOTE At1g01140 HITS CSHL_GT24847 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR W/64917-65429 HITS CSHL_GT24846 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-154 LOCN Exon COOR W/64927-65202 HITS CSHL_GT24842 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Intron COOR W/65027-65431 HITS WiscDsLox433A3 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN Intron COOR W/65310-65670 HITS GABI_787F12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-19 LOCN Exon COOR C/65700-65766 NOTE - - HITS SALKseq_045486.101 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/65959-65959 NOTE KO411841 Salk 20K 1:65873 GCATATCTCTTATATACATCATAAATAAAGAAGATTCTGCAAATGAAGTCTATACGTATAATGTGGTGTAAACAAATTG HITS SALK_058629.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-104 LOCN Exon COOR C/66301-66511 HITS SALKseq_131363.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/66621-66621 NOTE KO400623 Salk 40K 1:66622 TTAACATAAGAGTAAGAAGAGAGAAAGACAGAGAACATTGCGGACAACAAATTGACAAATTGTGGTGTAAACAAATTG HITS SK996 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 4e-40 LOCN Intron COOR C/67114-67200 NOTE CS1000321 HITS SM_3_33089 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 7e-61 LOCN Intron COOR C/67142-67259 NOTE CS119800 HITS CSHL_ET10772 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Intron COOR W/67255-67574 HITS SALKseq_116171.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/67258-67258 NOTE KG793271 Salk 110K 1:67277 AAACATTAACCTTAATAACCGAACACCAACCTAGGAGGACATGTGGGTCCCTAATCACGAAATTAAACTGTTCTTTACGTGACAACTTAATAACACATTG HITS BX833652 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR W/67313-67951 HITS SALK_058184.48.30.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 9e-62 LOCN 300-UTR5 COOR C/67580-67698 HITS GABI_165F05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-130 LOCN 1000-Promotor COOR C/67602-67840 NOTE - - HITS SALKseq_082755.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/67743-67743 NOTE KO434276 Salk 70K 1:67742 GAAGAATGAACGTTACGAACGTACACAAGTACAAATAACACGGGACTTAGACAACTTAATGGATATATTGTGGTGTAA HITS SAIL_252b_F06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-130 LOCN 300-UTR5 COOR W/67794-68036 HITS SAIL_252_F06 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-130 LOCN 300-UTR5 COOR W/67794-68036 HITS SALKseq_058184.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/67840-67840 NOTE KO345562 Salk 40K 1:67841 CATTCATATAAAAAAATTCCATAATTTTGTTCTTGTGTGGTAACTATATACAAATTGACGCTTAGACAACTTAATTCT HITS RATM13-5046-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 3e-72 LOCN 1000-Promotor COOR W/67944-68172 HITS SALK_098102.47.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-91 LOCN 1000-Promotor COOR C/67962-68219 HITS WiscDsLox329F12 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR C/68065-68442 HITS SALKseq_083935.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/68302-68302 NOTE KO424559 Salk 70K 1:68301 AGTTCATATTCATACCGTTCCCTTGACTCACATCGTCACATGGAAAGATCAACTATTTGTGGTGTAAACAAATTTTGG