CODE AT1G01130.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01130.1 CDS ID=AT1G01130.1; Parent=AT1G01130; Name=AT1G01130.1; Note=CBL-interacting Serine/Threonine-kinase; conf_class=3; computational_description=CONTAINS InterPro DOMAIN/s: CBL-interacting protein kinase (InterPro:IPR020660)%2C Calcium/calmodulin-dependent protein kinase-like (InterPro:IPR020636)%3B BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G47170.1)%3B Has 176 Blast hits to 176 proteins in 20 species: Archae - 0%3B Bacteria - 0%3B Metazoa - 0%3B Fungi - 0%3B Plants - 176%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15703057, PMID:20226671, locus:2035357; locus_type=protein_coding COOR C/61905-61949,62050-62124,63557-63811 HITS SALKseq_134242.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/62043-62043 NOTE KO340533 Salk 110K 1:62022 TAAAATTAGAGGTAACTGAACCGGTTGGTAAAGATTAAACCGAAATAACCGATGTAAACAAATTGACAAATTGACGCTTAGAC HITS SALKseq_053083.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/62159-62159 NOTE KO375415 Salk 30K 1:62119 TGGTGCCACTTCAAACACCTATTATAACCGCTAACCAAATCAAAATAATCAGGATATATTGTGGTGTAAACAAATTGA HITS SALKseq_124972.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/62242-62242 NOTE KO380240 Salk 60K 1:62186 AAAACCGTACTAAACCGGAATGTTATCATTCCTATCTGTTTTTGTTCATAACTCTGTAGTGTAAACAAATTGACGCTTA HITS CSHL_GT9036 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Intron COOR W/62391-62925 HITS CSHL_GT9036 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-158 LOCN Intron COOR W/62407-62696 HITS SAIL_1279_F09 SAIL T-DNA Homozygous Knockout Line for At1g01130
[Seq] [SAIL HM Collection by Salk] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM EVAL 5e-22 LOCN Intron COOR C/62440-62501 NOTE At1g01130 HITS SAIL_1279_E08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 1e-19 LOCN Intron COOR C/62440-62501 HITS CSHL_GT8593 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Intron COOR C/62449-62807 HITS CSHL_GT8599 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Intron COOR C/62449-62821 HITS CSHL_GT8599 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-130 LOCN Intron COOR W/62827-63137 HITS SALKseq_41055.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/63103-63103 NOTE KO443844 Salk 50K 1:62916 CGAAAACTAACGTCAATAGCTTTTACTGTATCCAACAATATCTTCGGAGGCGTTTTCCCCAGGATATATTGTGGTGTA HITS CSHL_GT18403 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/63108-63651 HITS CSHL_GT18407 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/63108-63661 HITS SAIL_759_E07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-139 LOCN Intron COOR W/63202-63281,63503-63793 HITS SALK_065570.50.05.x SALK T-DNA Homozygous Knockout Line for At1g01130 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-36 LOCN Intron COOR C/63252-63327 NOTE At1g01130 HITS SALKseq_065570.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/63264-63264 NOTE KO382814 Salk 40K 1:63266 ACTAGTGACATATATTCACGTTCAAAAGTTTATCTTGCAAATCTTGGATTTCTTAGTTTCATTATCAGATTAAAACAG HITS DQ446217 [About TIGR ORFs] [GenBank] TYPE TIGR ORFs EVAL 99.55 LOCN Exon COOR C/63373-63811 HITS DQ652818 [About TIGR ORFs] [GenBank] TYPE TIGR ORFs EVAL 99.32 LOCN Exon COOR C/63374-63811 HITS WiscDsLox476E10 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN Intron COOR W/63452-64009 HITS SAIL_719_C10 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 4e-25 LOCN Intron COOR W/63454-63796 HITS RATM11-2739-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN 1000-Promotor COOR C/63589-64281 HITS CSHL_GT18403 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-167 LOCN Exon COOR W/63705-64025 HITS CSHL_GT18407 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-162 LOCN Exon COOR W/63708-63996 HITS SALKseq_135214.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/63711-63711 NOTE KO407473 Salk 10K 1:63792 GATGCCGACGCTGTTTCCTTGTCTGAAACCCTAGATTCGATCTCTTTCGGTTGATTCGATCTCGCGTAATCAGATTCTG HITS Wiscseq_DsLox391E05.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/63845-63845 NOTE KG802676 Wisc 10K 1:63823 TGAATCCCAATCACCCAAAATCTCTACACTCTCTGAATCTGAACGTTTCTCCATTCTTAAAAACTTTGGAATGCGAAATTTGCGACTTAATAACACATTG HITS GABIseq_037F10.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/63857-63857 NOTE KG780336 GABI 10K 1:63833 AAATCTCTACACTCTCTGAATCTGAACGTTTCTCCATTCTTAAAAACTTTGGAATGCGAAATTTGCGACTTTATGGGCTTTACATGGATCAGCAATGAGT HITS SALKseq_080845.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/64007-64007 NOTE KO437232 Salk 70K 1:63936 ACCACTCCGTCATCAATGTGTGACTGTACATCAAAATAAAACTTTTTTTTTTTGGTTGCAAACAAATTGACGCTTAGA HITS SAILseq_547_A03.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/64038-64038 NOTE KO324661 SAIL 30K 1:64087 GTTGAAAGTTGCAACGATGTTGTCGCTTTATGGCAACGCGTTACAATGACACAACATATATAACAATTTGGAAAACACAATGATAGAATTATTAA HITS SAIL_547_A03 SAIL T-DNA Homozygous Knockout Line for At1g01130
[Seq] [SAIL HM Collection by Salk] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM EVAL 5e-16 LOCN 1000-Promotor COOR W/64123-64254 NOTE At1g01130 HITS RAFL09-20-N24 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-149 LOCN 1000-Promotor COOR C/64171-64477,64584-64656 HITS RAFL04-16-A16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-166 LOCN 1000-Promotor COOR C/64182-64477,64584-64658,64753-64807,64901-65018,65111-65219,65333-65385 HITS R15436 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.82 LOCN 1000-Promotor COOR C/64182-64383,64382-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67619 NOTE AF386999 HITS FLAG_551A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 1000-Promotor COOR W/64182-64508 HITS BX817129 [GenBank] [Order] TYPE GSLT cDNA EVAL e-158 LOCN 1000-Promotor COOR C/64201-64477,64583-64658,64753-64807,64901-65018,65111-65216,65329-65456,65563-65652,65739-65866,66109-66159,66261-66342,66450-66557,66678-66751,66837-66897,67324-67606 HITS U15436 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP Gateway Clone EVAL 99.93 LOCN 1000-Promotor COOR C/64290-64475,64582-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 NOTE U15436 AY093242 pENTR-TOPO HITS SALKseq_132704.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/64364-64364 NOTE KO397330 Salk 20K 1:64235 CCAACTCCAGAATGTTTACTATTCATTATACATGTTCAACATTGACGCTTAGACAACTTAATACACTGAGATCGGAAGA HITS Wiscseq_DsLox433A3.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/64378-64378 NOTE KG804642 Wisc 10K 1:64356 CAGCAATACTTGTATATTGCCAACTCCAGAATGTTTACTATTCATTATACATGTTCAACATTGATTAAAAACTTTGAAAATTCAGGATCTATTGTGGTGT HITS SALK_132704.46.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/64389-64810 HITS AF295664 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN 1000-Promotor COOR C/64398-64475,64582-64653,64748-64807,64901-65017,65110-65217,65331-65456,65563-65652,65733-65858,66100-66160,66262-66342,66450-66557,66678-66746,66832-66897,67324-67512 HITS AF339147 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN 1000-Promotor COOR C/64398-64475,64570-64656,64751-64807,64901-65017,65110-65217,65331-65456,65563-65652,65739-65864,66107-66160,66262-66342,66450-66557,66678-66749,66835-66897,67324-67512 HITS SALK_133449.29.60.n SALK T-DNA Homozygous Knockout Line for At1g01140 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-154 LOCN 1000-Promotor COOR W/64457-64811 NOTE At1g01140 HITS SALKseq_138377.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/64464-64464 NOTE KO364130 Salk 80K 1:64461 CTGCATCAGTATTCCAGACTACATCCTTTAATCCAGATGAAAAGGATATATTGTGGTGTAAACAAATTGACGCTTAGA HITS FLAG_070B10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-105 LOCN 1000-Promotor COOR C/64508-64700 HITS FLAG_070H08 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-105 LOCN 1000-Promotor COOR C/64508-64700 HITS FLAG_071F01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-105 LOCN 1000-Promotor COOR C/64508-64700 HITS SALKseq_129041.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/64516-64516 NOTE KO387136 Salk 70K 1:64463 CAGATGAGAAGTTTTTGTAGAACTGCAAAAGAGATTCAAACATAAAACCAATTTAAACACTAACAAATTGACGCTTAGA HITS SALKseq_081549.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/64518-64518 NOTE KO424119 Salk 70K 1:64236 CGGTTCGGTTTTGATCCGGTTAACATCTCTAGCAAATAACAAGAAGAATTAAGCGCCAATATATTGTGGTGTAAACAAA