CODE AT1G01120.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01120.1 CDS ID=AT1G01120.1; Parent=AT1G01120; Name=AT1G01120.1; Note=3-ketoacyl-CoA synthase 1; curator_summary=Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis.; conf_class=1; symbol=KCS1; full_name=3-ketoacyl-CoA synthase 1; computational_description=3-ketoacyl-CoA synthase 1 (KCS1)%3B FUNCTIONS IN: fatty acid elongase activity%2C acyltransferase activity%3B INVOLVED IN: in 7 processes%3B LOCATED IN: cytosolic ribosome%2C endoplasmic reticulum%2C membrane%3B EXPRESSED IN: 29 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039)%2C Very-long-chain 3-ketoacyl-CoA synthase (InterPro:IPR012392)%2C 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C-terminal (InterPro:IPR013747)%2C FAE1/Type III polyketide synthase-like protein (InterPro:IPR013601)%2C Thiolase-like%2C subgroup (InterPro:IPR016038)%3B BEST Arabidopsis thaliana protein match is: 3-ketoacyl-CoA synthase 11 (TAIR:AT2G26640.1)%3B Has 3961 Blast hits to 3946 proteins in 966 species: Archae - 0%3B Bacteria - 1388%3B Metazoa - 0%3B Fungi - 5%3B Plants - 2408%3B Viruses - 0%3B Other Eukaryotes - 160 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:10074711, PMID:11341960, PMID:12753585, PMID:15070782, PMID:18465198, PMID:18650403, PMID:20736450, PMID:22284369, PMID:23505340, locus:2200955; locus_type=protein_coding COOR C/57392-58978 HITS SALKseq_058071.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/57165-57165 NOTE KO352256 Salk 40K 1:57105 TATAGTATTTGTTAGTATGCAAGGTTTGCTTTATCATTTATGGGTGTGTCATTGCGGACAAATTGTGGTGTAAACAAA HITS BX817516 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/57254-58096 HITS RAFL08-10-E13 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-106 LOCN Exon COOR C/57272-57469 HITS RAFL08-10-E13 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.30 LOCN Exon COOR C/57272-59124 HITS RAFL22-99-L17 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 97.67 LOCN Exon COOR C/57279-57783 HITS RAFL22-31-L19 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 97.85 LOCN Exon COOR C/57287-58563 HITS R19207 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.21 LOCN Exon COOR C/57287-59167 NOTE AY074285 HITS RAFL09-59-C06 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/57288-57722 HITS BX815372 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/57303-59117 HITS U19207 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR C/57361-58978 NOTE AY096568 HITS G19207 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/57361-58978 NOTE U19207 AY096568 pENTR_Sfi HITS SALKseq_103920.3 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/57362-57362 NOTE KO436312 Salk 20K 1:57363 ATTTTCAATCGACAACTTACATCAACAATTAAAAAATAAAATCAAGAAGAACACAACCAAATTGACGCTTAGACAACTT HITS AF053345 [GenBank] TYPE Community DNA EVAL 100.00 LOCN Exon COOR C/57392-58954 HITS RATM13-5638-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR W/57646-58300 HITS BX840254 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/58104-59106 HITS GABI_060A10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-31 LOCN Exon COOR W/58361-58656 NOTE - - HITS SALK_200839 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 6e-108 LOCN Exon COOR W/58523-58733 NOTE JS804452.1 HITS GABI_013E09 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 2e-08 LOCN Exon COOR W/58549-58581 NOTE at1g05570 CS401209 HITS GABI_312G10 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 2e-96 LOCN 300-UTR5 COOR C/58607-58784,58845-59020 NOTE at1g01120 CS429938 HITS GABI_312G10 GABI-Kat T-DNA Homozygous Knockout Line for AT1G01120 by Salk [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat HM EVAL 2e-96 LOCN 300-UTR5 COOR C/58607-58784,58845-59020 NOTE AT1G01120 CS429938 HITS GABI_314G10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-67 LOCN Exon COOR C/58607-58735 NOTE - - HITS SALKseq_072473.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/58638-58638 NOTE KO346411 Salk 50K 1:58639 CTGATATTTTACGCTCGTCTTCCGGTTTGTAGCAGGAGAAATCCACTAGGTAAACCGGTTTAGACCGGTTAGCCACGT HITS FLAG_121H04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 2e-37 LOCN Exon COOR C/58699-58776 HITS SALKseq_052471.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/58705-58705 NOTE KO382077 Salk 30K 1:58704 CGGTCTAACGTTCGATACGTTCTCTGAGCTTTGGTCTAACCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGAC HITS SAIL_824_D02 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-117 LOCN Exon COOR W/58721-58942 HITS SALKseq_124418.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/58805-58805 NOTE KO410291 Salk 60K 1:58726 GGTTAGCTGAACCAGCACGGTTCCGGTTAAAGGAAGAATAATTAAGAAGAAGAGAATGTACTGGGGTGGCAAACAAATTGACGCTTAGACAACTT HITS SALKseq_124418.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/58810-58810 NOTE KO413647 Salk 60K 1:58809 TATTAACGTCCGTTAAGCTCAAATACGTGAAGCTTGGACTTCACAACTCTTGCAACGTGAAGACAAATTGACGCTTAGA HITS SALK_074123.45.95.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-35 LOCN Exon COOR W/58810-58892 HITS SALKseq_089687.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/58822-58822 NOTE KO432275 Salk 80K 1:58821 TGCCGGATTTATTAACGTCCGTTAAGCTCAAATACGTGAAGCTTGGACTTCACAACTTAATTGACGCTTAGACAACTT HITS SALK_074121.35.25.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-77 LOCN Exon COOR W/58838-59087 HITS FLAG_411H04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN Exon COOR W/58839-59187 HITS SALK_069823.48.05.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-141 LOCN Exon COOR W/58885-59159 HITS SAILseq_323_A05.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/58954-58954 NOTE KO330292 SAIL 30K 1:58915 TTCTTATAACGGCCGATGATGAATCTCGAAACGCCATCTCCGCCGTTAATCTCTCTCGATCCATTATTGTATACAAATTGACGCTTAAACAACTT HITS SALK_036681.33.95.x SALK T-DNA Homozygous Knockout Line for At1g01120 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-37 LOCN 300-UTR5 COOR C/59094-59183 NOTE At1g01120 HITS SALK_036681.54.65.x SALK T-DNA Homozygous Knockout Line for At1g01120 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 2e-53 LOCN 300-UTR5 COOR C/59094-59198 NOTE At1g01120 HITS RATM11-3824-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 3e-59 LOCN 300-UTR5 COOR W/59113-59228 HITS GABI_338A01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-57 LOCN 300-UTR5 COOR W/59118-59229 NOTE - - HITS SALKseq_036681.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/59201-59201 NOTE KO404714 Salk 10K 1:59202 AAGTAGGGATGGAGAGATATATAGAGTGCAAGAAAGATAAAAATATTTTAAAGATTAATAATATTGTGGTGTAAACAAA HITS SALK_140191.44.65.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-39 LOCN 1000-Promotor COOR C/59216-59305 HITS WiscDsLox499E01 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 1e-76 LOCN 1000-Promotor COOR C/59217-59361 HITS SALK_140191.44.65.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 9e-33 LOCN 1000-Promotor COOR C/59228-59305 HITS SALKseq_061233.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/59266-59266 NOTE KO365808 Salk 40K 1:59265 TGACTACTTAATTTAATATCAAGGTCCCATATAAGTAGTTGAGCTAATAGTATTATCTCTCAGGATATATTGTGGTGT HITS SAILseq_233_B04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/59269-59269 NOTE KO328903 SAIL 20K 1:59300 GTGAACAAAACATGAAAAATAATCTGACTAATTAATTTAATATCAAGGTCTCATATAAGTAGTTGAGCTAATAGCATATATTGTGGTGTACACAA HITS SALKseq_140191.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/59310-59310 NOTE KO340704 Salk 110K 1:59288 AAAAAGATGGAATAATATTCGAATTTAATGATGGGTGGTTCCGAGATAATACTATTAGCTCAACTACTTATATGGGACCTTGATATTGTGGTGTAAACAA HITS SALK_148218.52.40.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-177 LOCN 1000-Promotor COOR C/59531-59884 HITS SM_3_17134 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 7e-10 LOCN 1000-Promotor COOR W/59744-59775 NOTE CS104650 104650