CODE AT1G01110.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01110.1 CDS ID=AT1G01110.1; Parent=AT1G01110; Name=AT1G01110.1; Note=IQ-domain 18; conf_class=1; symbol=IQD18; full_name=IQ-domain 18; computational_description=IQ-domain 18 (IQD18)%3B FUNCTIONS IN: molecular_function unknown%3B LOCATED IN: mitochondrion%3B EXPRESSED IN: 10 plant structures%3B EXPRESSED DURING: 6 growth stages%3B BEST Arabidopsis thaliana protein match is: IQ-domain 17 (TAIR:AT4G00820.1)%3B Has 1112 Blast hits to 678 proteins in 50 species: Archae - 0%3B Bacteria - 10%3B Metazoa - 109%3B Fungi - 16%3B Plants - 528%3B Viruses - 4%3B Other Eukaryotes - 445 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, PMID:16368012, PMID:17551672, locus:2200945; locus_type=protein_coding COOR W/53022-53183,53484-53624,53703-54494 HITS SALK_041193.52.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/52064-52546 HITS SAIL_793_F05 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-126 LOCN 1000-Promotor COOR C/52333-52608 HITS SALKseq_36285.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/52817-52817 NOTE KO449562 Salk 40K 1:52816 GAAATCCCAATCTTTTAAATGGTAGATCTTGTATAAGCAATGTTAATTTTATAGACATAGACAACTTAATAACACATT HITS AY085363 [GenBank] TYPE Community cDNA EVAL 97.01 LOCN Exon COOR W/52869-53183,53484-53624,53703-54685 HITS GT_5_112508 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL e-136 LOCN Exon COOR W/53544-53799 NOTE CS173218 HITS SALK_142253.29.85.x SALK T-DNA Homozygous Knockout Line for At1g01110 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 1e-67 LOCN Exon COOR W/53940-54105 NOTE At1g01110 HITS SALK_144532.50.15.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-134 LOCN Exon COOR C/54100-54439 HITS SALK_010926.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-70 LOCN Exon COOR C/54102-54235 HITS SALK_144530.43.60.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-37 LOCN Exon COOR C/54244-54331,54357-54435 HITS SALK_144523.44.55.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 1e-27 LOCN Exon COOR C/54356-54430 HITS SALKseq_115661.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/54496-54496 NOTE KG793045 Salk 100K 1:54471 TCATGTTGCACTGAGTCTAACGGTGTTGAGATCTCTCCAGCTTCTACTAGTGACTTTAGGAATTGGCTTAGATGATTTTAAAATTGACGCTTAGACAACT