CODE AT1G01100.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01100.2 CDS ID=AT1G01100.2; Parent=AT1G01100; Name=AT1G01100.2; Note=60S acidic ribosomal protein family; conf_class=2; computational_description=60S acidic ribosomal protein family%3B FUNCTIONS IN: structural constituent of ribosome%3B INVOLVED IN: translational elongation%3B LOCATED IN: cytosol%2C cytosolic ribosome%2C ribosome%2C nucleus%2C plasma membrane%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 14 growth stages%3B CONTAINS InterPro DOMAIN/s: Ribosomal protein 60S (InterPro:IPR001813)%3B BEST Arabidopsis thaliana protein match is: 60S acidic ribosomal protein family (TAIR:AT5G47700.2)%3B Has 2175 Blast hits to 2175 proteins in 383 species: Archae - 76%3B Bacteria - 0%3B Metazoa - 858%3B Fungi - 474%3B Plants - 451%3B Viruses - 0%3B Other Eukaryotes - 316 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:11598216, PMID:12093376, PMID:14730065, PMID:15010618, PMID:15734919, PMID:15703057, PMID:17934214, PMID:18433157, PMID:18775970, PMID:22195043, locus:2200985; locus_type=protein_coding COOR C/50284-50337,50419-50631,50883-50954 HITS SAIL_292_E09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-12 LOCN 300-UTR3 COOR C/49922-50107 HITS SK17839 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-162 LOCN 300-UTR3 COOR W/50058-50402 NOTE CS1004015 HITS SK17832 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 9e-67 LOCN 300-UTR3 COOR W/50059-50246 NOTE CS1004011 HITS R11265 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 97.72 LOCN Exon COOR C/50089-50337,50419-50631,50883-50963,51126-51182 NOTE AY050975 HITS RAFL08-15-M13 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-139 LOCN Exon COOR C/50091-50339,50486-50608 HITS BX840478 [GenBank] [Order] TYPE GSLT cDNA EVAL e-113 LOCN Exon COOR C/50096-50296,50418-50632,50883-50965,51128-51174 HITS GABI_810G01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-18 LOCN 300-UTR3 COOR W/50099-50145 NOTE - - HITS BX816971 [GenBank] [Order] TYPE GSLT cDNA EVAL e-125 LOCN Exon COOR C/50113-50339,50421-50632,50884-50965,51128-51176 HITS BX818525 [GenBank] [Order] TYPE GSLT cDNA EVAL e-118 LOCN Exon COOR C/50113-50336,50418-50632,50884-50965,51128-51157 HITS BX841793 [GenBank] [Order] TYPE GSLT cDNA EVAL 2e-94 LOCN Exon COOR C/50113-50335,50418-50632,50883-50965,51129-51169 HITS AY086359 [GenBank] TYPE Community cDNA EVAL 99.82 LOCN Exon COOR C/50117-50337,50419-50631,50883-50963,51064-51108 HITS Wiscseq_DsLox489-492A6.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/50144-50144 NOTE KG808351 Wisc 10K 1:50122 TAAAGACCTATATTTGATGAACGAAGACTTGGTAGAAAATAAACAAAATCAATTCTAACAAAAGCCCGAGCCGATTGGTTTGCTTAATAACACATTGCGG HITS FLAG_353D04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 300-UTR3 COOR W/50145-50816 HITS WiscDsLox489-492A6 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 300-UTR3 COOR W/50164-50896 HITS SAILseq_292_E09.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/50216-50216 NOTE KO336146 SAIL 30K 1:50219 AAGCCCGAGCCGATTGGTTTGCTAGGAAACTTGAGTTATACAACATACGCATCATAAACCAACTAATAGTCCTTTAGCCAGATCAAACAAGTAAT HITS WiscDsLoxHs143_01E [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 3e-64 LOCN 300-UTR3 COOR W/50222-50349 HITS SK30975 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 2e-80 LOCN 300-UTR3 COOR W/50224-50414 NOTE CS1010700 HITS SALKseq_037678.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/50226-50226 NOTE KO384727 Salk 20K 1:50141 AATAGTCCTTTAGCCAGATCAAACAAGTAATAATAACTCATTGACGCTTAGACAACTTAATTGGTATAGATCGGAAGAG HITS U11265 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR C/50253-50337,50419-50631,50883-50954 NOTE AY091176 HITS G11265 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/50253-50337,50419-50631,50883-50954 NOTE U11265 AY091176 pENTR_Sfi HITS SALKseq_090022.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/50578-50578 NOTE KO419075 Salk 80K 1:50529 CATGATGAGATCAGTCACGTTACGTTTCTCAGCCATCTTGGCGAAGAGCATTGGCCAGGATATATTGTTGTGTAAACA HITS SALK_206736 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 8e-91 LOCN Exon COOR W/50631-50810 NOTE JS806990.1 HITS FLAG_361B08 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 4e-96 LOCN 300-UTR5 COOR C/51025-51205 HITS SAIL_210_H01 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-49 LOCN 300-UTR5 COOR C/51065-51176 HITS WiscDsLoxHs015_08H [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR W/51419-52171