CODE AT1G01090.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01090.1 CDS ID=AT1G01090.1; Parent=AT1G01090; Name=AT1G01090.1; Note=pyruvate dehydrogenase E1 alpha; curator_summary=pyruvate dehydrogenase E1 alpha subunit; conf_class=2; symbol=PDH-E1 ALPHA; full_name=pyruvate dehydrogenase E1 alpha; computational_description=pyruvate dehydrogenase E1 alpha (PDH-E1 ALPHA)%3B FUNCTIONS IN: pyruvate dehydrogenase (acetyl-transferring) activity%3B INVOLVED IN: oxidation reduction%2C glycolysis%2C metabolic process%3B LOCATED IN: chloroplast%2C plastid%2C chloroplast envelope%3B EXPRESSED IN: 25 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Dehydrogenase%2C E1 component (InterPro:IPR001017)%2C Pyruvate dehydrogenase (acetyl-transferring) E1 component%2C alpha subunit%2C subgroup y (InterPro:IPR017597)%3B BEST Arabidopsis thaliana protein match is: pyruvate dehydrogenase complex E1 alpha subunit (TAIR:AT1G59900.1)%3B Has 10065 Blast hits to 10059 proteins in 1888 species: Archae - 130%3B Bacteria - 6136%3B Metazoa - 517%3B Fungi - 241%3B Plants - 224%3B Viruses - 0%3B Other Eukaryotes - 2817 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:9393637, PMID:12084821, PMID:12805597, PMID:13677473, PMID:14576160, PMID:14682612, PMID:15052571, PMID:15173569, PMID:15561727, PMID:15703057, PMID:16553896, PMID:17419836, PMID:18650403, PMID:18616834, PMID:18689444, PMID:18775970, PMID:23505340, PMID:24023856, locus:2200980; locus_type=protein_coding COOR C/47705-47982,48075-48852,48936-49166 HITS SAIL_1231_A08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-77 LOCN 300-UTR3 COOR C/47438-47672 HITS RAFL09-16-O16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.27 LOCN Exon COOR C/47483-47982,48075-48852,48936-49279 HITS R13800 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.94 LOCN Exon COOR C/47498-47982,48075-48852,48936-49222,49207-49278 NOTE AY052721 HITS RAFL09-16-O16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-170 LOCN Exon COOR C/47513-47890 HITS RAFL09-56-N18 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/47513-47901 HITS RAFL06-74-I08 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN Exon COOR C/47516-47899 HITS BX815342 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/47541-47982,48074-48853,48938-49272 HITS FLAG_521F10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN Exon COOR C/47586-48220 HITS BX835986 [GenBank] [Order] TYPE GSLT cDNA EVAL e-164 LOCN Exon COOR W/47588-47990,48076-48351 HITS U80185 [GenBank] TYPE Community cDNA EVAL 97.40 LOCN Exon COOR C/47597-47982,48075-48852,48936-49221,49208-49273 HITS BX815751 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/47621-47982,48075-48853,48939-49269 HITS BX818597 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/47621-47982,48075-48853,48937-49226 HITS BX815365 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/47634-47982,48073-48853,48938-49248 HITS BX813802 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/47646-47981,48072-48853,48933-49250 HITS U13800 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR C/47705-47982,48075-48852,48936-49166 NOTE AY063724 HITS G13800 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/47705-47982,48075-48852,48936-49166 NOTE U13800 AY063724 pENTR_Sfi HITS BX840037 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/48085-48853,48937-49222 HITS FLAG_427B04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN Exon COOR W/48150-49041 HITS BX839733 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/48204-48853,48935-49259 HITS BX839266 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/48260-48853,48938-49270 HITS SAIL_228_H08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 5e-22 LOCN Exon COOR C/48630-48727,49066-49124 HITS BX840016 [GenBank] [Order] TYPE GSLT cDNA EVAL e-110 LOCN Exon COOR C/48654-48852,48935-49156 HITS WiscDsLoxHs111_07B [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN Exon COOR W/48787-49220 HITS SALK_100132.47.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-50 LOCN 300-UTR5 COOR C/49208-49308 HITS SALK_005653.47.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR C/49209-49680 HITS SALK_090259.54.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR C/49214-49671 HITS SALK_100132.47.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-42 LOCN 300-UTR5 COOR C/49223-49308 HITS SAIL_777_C08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 3e-66 LOCN 300-UTR5 COOR C/49242-49385 HITS SAIL_561_C08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 9e-73 LOCN 300-UTR5 COOR C/49243-49385 HITS SAIL_777_A08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 4e-75 LOCN 300-UTR5 COOR C/49243-49385 HITS SAIL_777_A08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 4e-48 LOCN 300-UTR5 COOR C/49244-49385 HITS SK26458 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR C/49245-49624 NOTE CS1008292 HITS SAIL_777_C08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 3e-57 LOCN 300-UTR5 COOR C/49245-49385 HITS SAIL_87_E08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR C/49251-49839 HITS SK23650 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR C/49258-49847 NOTE CS1006809 HITS SK23670 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR C/49264-49847 NOTE CS1006819 HITS SK23661 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR C/49278-49847 NOTE CS1006814 HITS SALKseq_67044.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/49291-49291 NOTE KO442282 Salk 70K 1:49290 ATTTTTCGAACAAACAAATAAAAATATATATAAGTATTTAGAGCCGGGATCGTTTATTTTGGTGTAAACAAATTGACG HITS SALK_090259.54.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR C/49292-49671 HITS SALK_005653.47.20.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR C/49293-49680 HITS SALK_003489.53.80.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR C/49336-49723 HITS SAILseq_777_C08.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR W/49437-49437 NOTE KO328594 SAIL 40K 1:49483 TAATTTGATGATTCCACTATTGATTAACCAATTCGAGTTAAAGAAGAAAATAAATTATGTTGAGCATACTTAACAAGGTTTATATTGTGGTGTAAACAAT HITS SAIL_26_D05 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR W/49610-50294 HITS SAIL_26_D05 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 7e-71 LOCN 1000-Promotor COOR W/49635-49880 HITS SALKseq_090259.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/49678-49678 NOTE KO429051 Salk 80K 1:49619 TTCTTTAAGATTTGTATATAATCCCATAAATCTTTTGTTATCAGGTAGAGCTATAGATGCAAATTGACGCTTAGACAA HITS GABI_127D07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-179 LOCN 1000-Promotor COOR W/49708-50036 NOTE - - HITS GABI_418D03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN 1000-Promotor COOR W/49810-50145 NOTE - - HITS SK17164 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR W/49832-50297 NOTE CS1003639 HITS SAIL_248_H12 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR W/49843-50427 HITS GABI_318B05 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-148 LOCN 1000-Promotor COOR W/49849-50145 NOTE - - HITS SALKseq_053606.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/49892-49892 NOTE KO388832 Salk 30K 1:49891 ATGCCTTTATTATCGGAACATGTTAGTGTTTGTTCTTCTTCTTACCCAGCAGCGTCAATGTACTGGGGTGGACTATAACAAATTGACGCTTAGAC HITS SAIL_174_B09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR W/49906-50426 HITS SAIL_292_E09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-12 LOCN 1000-Promotor COOR C/49922-50107 HITS SK17839 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL e-162 LOCN 1000-Promotor COOR W/50058-50402 NOTE CS1004015 HITS SK17832 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 9e-67 LOCN 1000-Promotor COOR W/50059-50246 NOTE CS1004011 HITS R11265 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 97.72 LOCN 1000-Promotor COOR C/50089-50337,50419-50631,50883-50963,51126-51182 NOTE AY050975 HITS RAFL08-15-M13 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-139 LOCN 1000-Promotor COOR C/50091-50339,50486-50608 HITS BX840478 [GenBank] [Order] TYPE GSLT cDNA EVAL e-113 LOCN 1000-Promotor COOR C/50096-50296,50418-50632,50883-50965,51128-51174 HITS GABI_810G01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-18 LOCN 1000-Promotor COOR W/50099-50145 NOTE - - HITS BX816971 [GenBank] [Order] TYPE GSLT cDNA EVAL e-125 LOCN 1000-Promotor COOR C/50113-50339,50421-50632,50884-50965,51128-51176 HITS BX818525 [GenBank] [Order] TYPE GSLT cDNA EVAL e-118 LOCN 1000-Promotor COOR C/50113-50336,50418-50632,50884-50965,51128-51157 HITS BX841793 [GenBank] [Order] TYPE GSLT cDNA EVAL 2e-94 LOCN 1000-Promotor COOR C/50113-50335,50418-50632,50883-50965,51129-51169 HITS AY086359 [GenBank] TYPE Community cDNA EVAL 99.82 LOCN 1000-Promotor COOR C/50117-50337,50419-50631,50883-50963,51064-51108 HITS Wiscseq_DsLox489-492A6.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/50144-50144 NOTE KG808351 Wisc 10K 1:50122 TAAAGACCTATATTTGATGAACGAAGACTTGGTAGAAAATAAACAAAATCAATTCTAACAAAAGCCCGAGCCGATTGGTTTGCTTAATAACACATTGCGG HITS FLAG_353D04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN 1000-Promotor COOR W/50145-50816 HITS WiscDsLox489-492A6 [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN 1000-Promotor COOR W/50164-50896