CODE AT1G01080.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01080.1 CDS ID=AT1G01080.1; Parent=AT1G01080; Name=AT1G01080.1; Note=RNA-binding (RRM/RBD/RNP motifs) family protein; conf_class=2; computational_description=RNA-binding (RRM/RBD/RNP motifs) family protein%3B FUNCTIONS IN: RNA binding%2C nucleotide binding%2C nucleic acid binding%3B INVOLVED IN: biological_process unknown%3B LOCATED IN: chloroplast stroma%2C nucleus%2C chloroplast%2C chloroplast envelope%3B EXPRESSED IN: 23 plant structures%3B EXPRESSED DURING: 13 growth stages%3B CONTAINS InterPro DOMAIN/s: RNA recognition motif%2C RNP-1 (InterPro:IPR000504)%2C Nucleotide-binding%2C alpha-beta plait (InterPro:IPR012677)%3B BEST Arabidopsis thaliana protein match is: RNA-binding (RRM/RBD/RNP motifs) family protein (TAIR:AT1G60000.1)%3B Has 509067 Blast hits to 499893 proteins in 22124 species: Archae - 10819%3B Bacteria - 303967%3B Metazoa - 99035%3B Fungi - 14863%3B Plants - 31737%3B Viruses - 35534%3B Other Eukaryotes - 13112 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:14576160, PMID:15703057, PMID:18650403, locus:2200975; locus_type=protein_coding COOR C/45503-45559,45646-45954,46044-46145,46376-46789 HITS GABI_071H12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-39 LOCN 300-UTR3 COOR C/45082-45219 NOTE - - HITS AY086138 [GenBank] TYPE Community cDNA EVAL 99.81 LOCN Exon COOR C/45349-45559,45646-45954,46044-46145,46376-46817 HITS RAFL09-07-K17 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-128 LOCN Exon COOR C/45386-45559,45646-45892 HITS R14066 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 100.00 LOCN Exon COOR C/45386-45559,45646-45954,46044-46145,46376-46813 NOTE AF419554 HITS U14066 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR C/45503-45559,45646-45954,46044-46145,46376-46789 NOTE AY132012 HITS G14066 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/45503-45559,45646-45954,46044-46145,46376-46789 NOTE U14066 AY132012 pENTR_Sfi HITS SM_3_2477 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Exon COOR C/45507-45951 NOTE CS109564 109564 HITS SM_3_21793 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Exon COOR C/45508-45951 NOTE CS110412 110412 HITS CSHL_ET148 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Exon COOR C/45942-46436 HITS CSHL_ET148 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL e-112 LOCN Exon COOR C/46116-46421 HITS GABI_511A03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN 300-UTR5 COOR C/46441-46901 NOTE - - HITS CSHL_ET79 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 8e-12 LOCN Exon COOR W/46444-46494 HITS CSHL_GT798 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 8e-12 LOCN Exon COOR W/46448-46494 HITS SAIL_670_F07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-105 LOCN 300-UTR5 COOR C/46747-46960 HITS SAIL_672_A07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-30 LOCN 300-UTR5 COOR C/46749-46852 HITS SAIL_1272_E03 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-170 LOCN 1000-Promotor COOR C/46750-47092 HITS SK33795 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 0.0 LOCN 1000-Promotor COOR C/46751-47121 NOTE CS1012261 HITS SAIL_107_E07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN 1000-Promotor COOR C/46755-47347 HITS RATM11-2411-1_H [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 0.0 LOCN Exon COOR W/46776-47446 HITS FLAG_089D01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 2e-09 LOCN 300-UTR5 COOR W/46809-46839 HITS FLAG_110E02 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 4e-12 LOCN 300-UTR5 COOR W/46809-46889 HITS SALK_009918.52.45.x SALK T-DNA Homozygous Knockout Line for At1g01080 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 9e-49 LOCN 300-UTR5 COOR C/46855-46951 NOTE At1g01080 HITS SALK_043415.22.65.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-14 LOCN 300-UTR5 COOR W/46929-46976,47270-47349 HITS GABI_846E02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-120 LOCN 300-UTR5 COOR W/46974-47255 NOTE - - HITS SALKseq_131594.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/46984-46984 NOTE KO393955 Salk 50K 1:46908 GTAGCAGGTTTTGTTTTTCATGAAATAAACAAAAGGCCCAAAGTCTCTTATTAAGCAAATTGACGCTTAGACAACTTA HITS FLAG_015B10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-148 LOCN 300-UTR5 COOR W/47051-47314 HITS SALKseq_131503.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/47090-47090 NOTE KO383903 Salk 30K 1:47091 CAAGTCTCTTATTCCCTTTACCAAACACTTTAATTACAAAGAAAGTAGGAGCCATGAAATTAATAACACATTGCGGAT HITS GABI_511A03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-138 LOCN 1000-Promotor COOR W/47163-47425 NOTE - - HITS SALK_043415.14.55.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 5e-12 LOCN 1000-Promotor COOR W/47270-47349 HITS SALKseq_143.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/47354-47354 NOTE KO449038 Salk 10K 1:47355 AGAAGTCTGCAAATCTTGAGGTTTAAAGCTATATTATAAGCAAGCTATGCAGAGATGAAGCAAACAAATTGACGCTTAG HITS SAIL_1231_A08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 2e-77 LOCN 1000-Promotor COOR C/47438-47672 HITS RAFL09-16-O16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.27 LOCN 1000-Promotor COOR C/47483-47982,48075-48852,48936-49279 HITS R13800 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.94 LOCN 1000-Promotor COOR C/47498-47982,48075-48852,48936-49222,49207-49278 NOTE AY052721 HITS RAFL09-16-O16 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-170 LOCN 1000-Promotor COOR C/47513-47890 HITS RAFL09-56-N18 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN 1000-Promotor COOR C/47513-47901 HITS RAFL06-74-I08 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL 0.0 LOCN 1000-Promotor COOR C/47516-47899 HITS BX815342 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR C/47541-47982,48074-48853,48938-49272 HITS BX835986 [GenBank] [Order] TYPE GSLT cDNA EVAL e-164 LOCN 1000-Promotor COOR W/47588-47990,48076-48351 HITS U80185 [GenBank] TYPE Community cDNA EVAL 97.40 LOCN 1000-Promotor COOR C/47597-47982,48075-48852,48936-49221,49208-49273 HITS BX815751 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR C/47621-47982,48075-48853,48939-49269 HITS BX818597 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR C/47621-47982,48075-48853,48937-49226 HITS BX815365 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR C/47634-47982,48073-48853,48938-49248 HITS BX813802 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN 1000-Promotor COOR C/47646-47981,48072-48853,48933-49250 HITS U13800 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN 1000-Promotor COOR C/47705-47982,48075-48852,48936-49166 NOTE AY063724 HITS G13800 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN 1000-Promotor COOR C/47705-47982,48075-48852,48936-49166 NOTE U13800 AY063724 pENTR_Sfi