CODE AT1G01070.2 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01070.2 CDS ID=AT1G01070.2; Parent=AT1G01070; Name=AT1G01070.2; Note=nodulin MtN21 /EamA-like transporter family protein; curator_summary=nodulin MtN21-like transporter family protein; conf_class=1; symbol=UMAMIT28; full_name=Usually multiple acids move in and out Transporters 28; computational_description=nodulin MtN21 /EamA-like transporter family protein%3B LOCATED IN: membrane%3B EXPRESSED IN: 17 plant structures%3B EXPRESSED DURING: 7 growth stages%3B CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF6%2C transmembrane (InterPro:IPR000620)%3B BEST Arabidopsis thaliana protein match is: nodulin MtN21 /EamA-like transporter family protein (TAIR:AT1G11460.1)%3B Has 3211 Blast hits to 3199 proteins in 599 species: Archae - 23%3B Bacteria - 1686%3B Metazoa - 4%3B Fungi - 6%3B Plants - 1233%3B Viruses - 0%3B Other Eukaryotes - 259 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:15703057, locus:2200990; locus_type=protein_coding COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40597 HITS SALK_088760.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 3e-87 LOCN 300-UTR3 COOR C/38455-38616 HITS SALKseq_088760.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR C/38616-38616 NOTE KO422161 Salk 80K 1:38563 TTTTTTGAAGTTGACGGCCTCATCGGTCAGGAAGCCACATAATACATTGACGCTTAGACAACTTAATGTTAGCAGATC HITS GABI_554G07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-71 LOCN 300-UTR3 COOR C/38659-38794 NOTE - - HITS AY089039 [GenBank] TYPE Community cDNA EVAL 99.92 LOCN Exon COOR C/38753-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40944 HITS BX816186 [GenBank] [Order] TYPE GSLT cDNA EVAL e-117 LOCN Exon COOR C/38790-39057,39139-39285,39408-39816,40215-40330,40474-40537 HITS GABI_545G07 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-09 LOCN 300-UTR3 COOR W/38812-38850 NOTE - - HITS S68296 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk cDNA EVAL 100.00 LOCN Exon COOR C/38815-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40912 NOTE BT015826 HITS U68296 [SALK] [About & Citation] [NCBI] [Order from ABRC] TYPE Salk pUni Clone EVAL 100.00 LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40877 NOTE BT020209 HITS G68296 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/38898-39054,39136-39287,39409-39814,40213-40329,40473-40535,40675-40877 NOTE U68296 BT020209 pENTR_Sfi HITS FLAG_094G04 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-176 LOCN Intron COOR W/39059-39369 HITS FLAG_098D09 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-173 LOCN Intron COOR W/39059-39369 HITS FLAG_101B10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-173 LOCN Intron COOR W/39059-39369 HITS FLAG_172F01 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-168 LOCN Intron COOR W/39059-39369 HITS SM_3_36636 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Intron COOR W/39076-39519 NOTE CS123347 HITS SM_3_36639 [Seq] [JIC SM] [Order from ABRC] [Order from NASC] [PCR @ Salk Site] [PCR @ genome-enterprise.com] TYPE JIC SM Line EVAL 0.0 LOCN Intron COOR W/39076-39458 NOTE CS123350 HITS SALKseq_033491.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/39209-39209 NOTE KO391217 Salk 10K 1:39209 GATACCTTCCAAGGTATAAAGGAGTGTGTAAAATGAGGAAATCAAATAGAGTAGCCGAAATGAGAGTAAGTGGGAAAAA HITS SALKseq_122548.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/39230-39230 NOTE KO363368 Salk 60K 1:39229 TGTGGGTTTTTTTATGTGGTTTTTTTTTATCATATATTATAGGGAGTGGTAGGACAAGCAATGACGACGGTTGCAACAACATGGGGGATTAAAAAATTAG HITS CSHL_ET6318 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN Intron COOR C/39332-39972 HITS SALK_099741.25.60.x SALK T-DNA Homozygous Knockout Line for At1g01070 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL e-136 LOCN Exon COOR C/39398-39801 NOTE At1g01070 HITS SALKseq_036290.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/39524-39524 NOTE KO341120 Salk 10K 1:39526 TATGGATGTTGTTTCAAGGGACTTTAAGTATTAAGTACCCTTGCAAATACTCGAGCACATTGCGGTGTAAACAAATTGA HITS SALKseq_58200.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/39852-39852 NOTE KO441843 Salk 60K 1:39849 CCTGCTTTGGTCTTTAGAATCTTCACATTTTCAGTCCTAAAAAAAGTAAAATTTTAATGATTATTTTGAACAAATTGCC HITS SALK_147481.36.95.x SALK T-DNA Homozygous Knockout Line for At1g01070 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 8e-56 LOCN Intron COOR W/39897-40009 NOTE At1g01070 HITS SALK_036290.39.55.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-134 LOCN Exon COOR C/40006-40250 HITS GABI_181G11 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL e-114 LOCN Intron COOR C/40157-40380 NOTE at1g01070 CS417363 HITS BX816126 [GenBank] [Order] TYPE GSLT cDNA EVAL 0.0 LOCN Exon COOR C/40212-40328,40472-40927 HITS SALK_087630.55.75.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-94 LOCN 1000-Promotor COOR W/41576-41749