CODE AT1G01050.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01050.1 CDS ID=AT1G01050.1; Parent=AT1G01050; Name=AT1G01050.1; Note=pyrophosphorylase 1; curator_summary=Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate.; conf_class=2; symbol=PPa1; Alias=AtPPa1, pyrophosphorylase 1; full_name=pyrophosphorylase 1; computational_description=pyrophosphorylase 1 (PPa1)%3B FUNCTIONS IN: inorganic diphosphatase activity%3B INVOLVED IN: phosphate metabolic process%2C metabolic process%3B LOCATED IN: nucleus%2C membrane%2C cytoplasm%3B EXPRESSED IN: 24 plant structures%3B EXPRESSED DURING: 15 growth stages%3B CONTAINS InterPro DOMAIN/s: Inorganic pyrophosphatase (InterPro:IPR008162)%3B BEST Arabidopsis thaliana protein match is: pyrophosphorylase 3 (TAIR:AT2G46860.1)%3B Has 5987 Blast hits to 5987 proteins in 1845 species: Archae - 172%3B Bacteria - 4313%3B Metazoa - 247%3B Fungi - 261%3B Plants - 270%3B Viruses - 0%3B Other Eukaryotes - 724 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:15135060, PMID:15610358, PMID:15703057, PMID:18775970, PMID:22566496, PMID:23438466, PMID:25663508, locus:2200965; locus_type=protein_coding COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 HITS SAIL_251_D07 SAIL T-DNA Homozygous Knockout Line for At1g01050
[Seq] [SAIL HM Collection by Salk] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL T-DNA HM EVAL 3e-20 LOCN Exon COOR C/30997-31241,31385-31523 NOTE At1g01050 HITS SAIL_155_D07 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-161 LOCN Intron COOR C/31011-31626 HITS RAFL08-11-E15 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.82 LOCN Exon COOR C/31183-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33114 HITS R13796 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 100.00 LOCN Exon COOR C/31186-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33114 NOTE AY052717 HITS RAFL06-74-O18 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-108 LOCN Exon COOR C/31188-31424,31521-31602,31693-31776 HITS AY085015 [GenBank] TYPE Community cDNA EVAL 99.90 LOCN Exon COOR C/31188-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33148 HITS R14690 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.78 LOCN Exon COOR C/31195-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33117 NOTE AY057668 HITS RAFL09-46-O10 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-122 LOCN Exon COOR C/31197-31424,31521-31602,31693-31776 HITS RAFL05-14-F05 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-114 LOCN Exon COOR C/31209-31424,31521-31602,31693-31815,31935-31997,32087-32197,32284-32348,32432-32460 HITS R16094 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.78 LOCN Exon COOR C/31209-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33118 NOTE AY065201 HITS U16094 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP Gateway Clone EVAL 100.00 LOCN Exon COOR C/31216-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 NOTE U16094 AY081555 pENTR-TOPO HITS BX841824 [GenBank] [Order] TYPE GSLT cDNA EVAL 3e-63 LOCN Exon COOR C/31285-31424,31521-31602,31693-31815,31935-31997,32087-32197,32284-32348,32432-32458,32546-32672,33032-33107 HITS SALKseq_107475.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/31364-31364 NOTE KO436371 Salk 20K 1:31363 CTCCACACCCTGAGGCGTTGAAGCTTCTCCTCAGAAGATCATGACACATTAATAACACAAATTGACGCTTAGACAACTT HITS SALKseq_056251.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/31375-31375 NOTE KO368871 Salk 30K 1:31373 ACTCTGGATTCTGAATTCCCCATTACAGGGACCTCTATGCTGAATACATTCTCCACACCCTGAGGCGTTGAAGCTTCT HITS U13796 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP pUni Clone EVAL 100.00 LOCN Exon COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 NOTE BT001144 HITS G13796 Invitrogen/Salk Gateway clone, originally SSP/Salk pUNI clone. [pENTR223 Seq] [pENTR223 Map] [Orignal SSP/SALK U] [Order from ABRC] TYPE GateWay Clone EVAL 100.00 LOCN Exon COOR C/31382-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 NOTE U13796 BT001144 pENTR_Sfi HITS SAIL_545_C05 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 0.0 LOCN Exon COOR C/31679-32304 HITS FLAG_083C10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 4e-29 LOCN Exon COOR C/31889-31952 HITS GABI_759C11 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-11 LOCN Intron COOR W/32401-32434 NOTE - - HITS SALK_093663.35.35.x SALK T-DNA Homozygous Knockout Line for At1g01050 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN 300-UTR5 COOR C/32509-32928 NOTE At1g01050 HITS GABI_750E08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-98 LOCN 300-UTR5 COOR C/32511-32695,32767-32946 NOTE - - HITS SALKseq_13109.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/32931-32931 NOTE KO440109 Salk 20K 1:32755 CTGAAAAGATGTATACCAAATCTGTTCACTTTTTCTCTATAGACTCGATGGATGACGCTTAGACAACTTAATACACTGA HITS GABI_750E08 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-94 LOCN 300-UTR5 COOR W/32946-33119 NOTE - - HITS GABI_814C02 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 6e-12 LOCN 1000-Promotor COOR W/33080-33118 NOTE - - HITS SALKseq_132342.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/33354-33354 NOTE KO407333 Salk 60K 1:33263 CTATGTAGGATACTTGCATTACATTTTTCACAAATAATTTGGTTTGGTAGCAAATTGACGCTTAGACAACTTAATGTTA HITS SALK_132342.46.50.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-67 LOCN 1000-Promotor COOR W/33360-33488 HITS RAFL07-43-F02 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 99.10 LOCN 1000-Promotor COOR C/33379-33589,33981-34327,34401-35474,35567-35647,35730-35963,36624-36685,36810-36921,37023-37111 HITS SALK_204146 SALK T-DNA Homozygous Knockout Line by Next Generation Sequencing. Insertion site might at the beginning or the end of the mapping
[GenBank [with the exact insertion site info)] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM NG EVAL 2e-133 LOCN 1000-Promotor COOR W/33534-33790 NOTE JS805842.1