CODE AT1G01040.1 [Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG] 
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene CHRO chr1 TITL AT1G01040.1 CDS ID=AT1G01040.1; Parent=AT1G01040; Name=AT1G01040.1; Note=dicer-like 1; curator_summary=Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state%2C others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs.; conf_class=2; symbol=DCL1; Alias=ASU1, ABNORMAL SUSPENSOR 1, ATDCL1, DICER-LIKE 1, CAF, CARPEL FACTORY, EMB60, EMBRYO DEFECTIVE 60, EMB76, EMBRYO DEFECTIVE 76, SIN1, SHORT INTEGUMENTS 1, SUS1, SUSPENSOR 1; full_name=dicer-like 1; computational_description=dicer-like 1 (DCL1)%3B CONTAINS InterPro DOMAIN/s: Restriction endonuclease%2C type I%2C R subunit/Type III%2C Res subunit (InterPro:IPR006935)%2C Double-stranded RNA-binding (InterPro:IPR001159)%2C Argonaute/Dicer protein%2C PAZ (InterPro:IPR003100)%2C Ribonuclease III (InterPro:IPR000999)%2C Double-stranded RNA-binding-like (InterPro:IPR014720)%2C DEAD-like helicase%2C N-terminal (InterPro:IPR014001)%2C DNA/RNA helicase%2C C-terminal (InterPro:IPR001650)%2C Helicase%2C superfamily 1/2%2C ATP-binding domain (InterPro:IPR014021)%2C Dicer double-stranded RNA-binding fold (InterPro:IPR005034)%3B BEST Arabidopsis thaliana protein match is: dicer-like 3 (TAIR:AT3G43920.2)%3B Has 21958 Blast hits to 17420 proteins in 2982 species: Archae - 328%3B Bacteria - 11461%3B Metazoa - 3615%3B Fungi - 1668%3B Plants - 1373%3B Viruses - 45%3B Other Eukaryotes - 3468 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10556049, PMID:8948599, PMID:8787738, PMID:7982564, PMID:12101121, PMID:12324593, PMID:12297633, PMID:12225663, PMID:12417148, PMID:12376646, PMID:12573220, PMID:12747833, PMID:12725739, PMID:12857820, PMID:14972688, PMID:15024409, PMID:15314213, PMID:15469823, PMID:15851028, PMID:16033795, PMID:16111943, PMID:16096641, PMID:16040244, PMID:16141062, PMID:16144699, PMID:15821876, PMID:16214897, PMID:16428603, PMID:16500993, PMID:16699516, PMID:16682354, PMID:16810317, PMID:16889646, PMID:17090584, PMID:17182867, PMID:17164336, PMID:17337628, PMID:17369351, PMID:17442570, PMID:17558406, PMID:17675322, PMID:18003861, PMID:18208512, PMID:18550839, PMID:18650403, PMID:18632581, PMID:18632569, PMID:18625233, PMID:18799732, PMID:18842626, PMID:18997003, PMID:19221817, PMID:17071740, PMID:18551175, PMID:19155326, PMID:19307293, PMID:19436261, PMID:19816405, PMID:20106953, PMID:20409179, PMID:20462493, PMID:20439431, PMID:20621980, PMID:20870966, PMID:19649244, PMID:19953107, PMID:21123653, PMID:21330492, PMID:21295131, PMID:21378120, PMID:21589905, PMID:21685453, PMID:22439910, PMID:22474216, PMID:22589469, PMID:22802657, PMID:22902697, PMID:22846193, PMID:23110057, PMID:23268445, PMID:23313986, PMID:23424246, PMID:23399598, PMID:23457227, PMID:23194006, PMID:23886622, PMID:23847640, PMID:23941160, PMID:23934148, PMID:23921632, PMID:24018204, PMID:24092744, PMID:24137006, PMID:24204292, PMID:24531234, PMID:24670663, PMID:24769482, PMID:24731939, PMID:24717238, PMID:24784759, PMID:25226037, PMID:25409478, PMID:25491479, PMID:25474114, PMID:25443390, PMID:23104109, locus:2200960; locus_type=protein_coding COOR W/23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31079 HITS SALK_134673.23.30.n [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 2e-70 LOCN 1000-Promotor COOR W/22537-22808 HITS SAIL_114_G08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-155 LOCN 1000-Promotor COOR C/22669-22974 HITS SALKseq_085706.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR C/23062-23062 NOTE KO421588 Salk 70K 1:23008 TAAATAAGTTACTTTTTACAAAGTCGAATAAATTATTTACCCTTCTGCTTTAATGGCAATTGACGCTTAGACAACTTAA HITS AF292941 [GenBank] TYPE Community DNA EVAL 99.93 LOCN Exon COOR W/23066-31204 HITS SALK_085706.54.10.x SALK T-DNA Homozygous Knockout Line for At1g01040 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN 1000-Promotor COOR W/23084-23514 NOTE At1g01040 HITS CSHL_ET1887 [Seq] [CSHL Ds] [Detail] [Order] TYPE CSHL FST EVAL 0.0 LOCN 1000-Promotor COOR W/23118-23446 HITS SALKseq_31431.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 1000-Promotor COOR W/23125-23125 NOTE KO440538 Salk 40K 1:23124 TTCTGAGATTCCACGGTCTATCGATCCCTACTCTGTTCTGTTTCTCTCTTCGTCTTCCTCTCTCTTCTGGTCTGTTTT HITS SALK_132615.52.10.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN 1000-Promotor COOR W/23125-23505 HITS AF292940 [GenBank] TYPE Community cDNA EVAL 99.89 LOCN Exon COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31153 HITS JN661701 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31227 HITS JN661702 [GenBank] TYPE Community cDNA EVAL 100.00 LOCN Exon COOR W/23146-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27687-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31227 HITS SALKseq_056243.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR5 COOR C/23270-23270 NOTE KO345459 Salk 30K 1:23199 GCAAAAGGGTTTTCAATTCCTATTTATTTACAAAGAAATCATCAATAGTTGTGGTGTAAACAAATTGACGCTTAGACA HITS SALK_056243.55.75.x SALK T-DNA Homozygous Knockout Line for At1g01040 [Seq] [Salk HM Collection] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA HM EVAL 0.0 LOCN 300-UTR5 COOR W/23316-23733 NOTE At1g01040 HITS AF187317 [GenBank] TYPE Community cDNA EVAL 99.97 LOCN Exon COOR W/23510-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,26292-26452,26543-26776,26862-27012,27099-27281,27372-27533,27618-27713,27803-28431,28708-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31155 HITS SALKseq_109692.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/23869-23869 NOTE KG789931 Salk 100K 1:23922 TGTAACTCCTCAGGTTATTGCTAAGGAGACAGTGAAGGAGAATGGGTTGCAAAAGAATGGCGGTAAGAGAGACGAATTCTCGAAATTGACGCTTAGACAA HITS SALK_081595.56.00.x [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL 0.0 LOCN Exon COOR C/23968-24388 HITS SALKseq_081595.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/24388-24388 NOTE KO437366 Salk 70K 1:24324 AAAGACACTTATCGCGACTCTTCTTATTAAAAGTGTTCATAAGGATCTGGGGTGGTTTTGGTGTAAACAAATTGACGCT HITS SAIL_442_D10 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL e-147 LOCN Intron COOR W/24511-24829 HITS FLAG_380A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-177 LOCN Exon COOR W/24641-24957 HITS FLAG_008A09 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 5e-44 LOCN Exon COOR C/24958-25049 HITS FLAG_278A12 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 9e-46 LOCN Exon COOR C/24958-25049 HITS FLAG_278C09 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 9e-46 LOCN Exon COOR C/24958-25049 HITS SALK_013118.55.25.n [Seq] [About & Citation] [Vector] [Order from ABRC] [Order from NASC] TYPE SALK T-DNA EVAL e-143 LOCN Exon COOR W/25232-25511 HITS RATM11-4195-1_G [Seq] [RARGE] [Order] TYPE RIKEN FST EVAL 2e-35 LOCN Exon COOR W/26108-26251 HITS SAIL_99_F09 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 8e-24 LOCN Exon COOR C/26572-26744 HITS SALKseq_39650.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/27013-27013 NOTE KO449724 Salk 40K 1:26970 ATGCACCGTTTGAAATACTTGAGGGTCCTGTTTGCAGTTCAATGCGTCTTGCACAACAGGATATATTGTGGTGTAAAC HITS SALKseq_136270.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR W/27015-27015 NOTE KO377431 Salk 80K 1:27014 GAACACTGAAAGAAAATAACAAGTAAGATAAACAAACAAACTATTATGTCCCTTAATAACAAATTGACGCTTAGACAA HITS GABI_725A02 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL e-180 LOCN Exon COOR C/27703-28042,28099-28250 NOTE at1g01040 CS469506 HITS GABI_693A09 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN Exon COOR C/27800-28299 NOTE at1g01040 CS466441 HITS GABI_725A02 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 2e-67 LOCN Exon COOR W/28250-28398 NOTE at1g01040 CS469506 HITS GABI_405E05 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 2e-82 LOCN Intron COOR C/28390-28551 NOTE at1g01040 CS438837 HITS GABI_405E05 GABI-Kat T-DNA Homozygous Knockout Line for AT1G01040 by Salk [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat HM EVAL 2e-82 LOCN Intron COOR C/28390-28551 NOTE AT1G01040 CS438837 HITS RAFL07-36-P21 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.54 LOCN Exon COOR W/28521-28805,28890-29080,29160-30065,30147-30311,30410-30816,30902-31183 HITS GABI_405E05 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 6e-17 LOCN Intron COOR W/28558-28610 NOTE at1g01040 CS438837 HITS GABI_405E05 GABI-Kat T-DNA Homozygous Knockout Line for AT1G01040 by Salk [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat HM EVAL 6e-17 LOCN Intron COOR W/28558-28610 NOTE AT1G01040 CS438837 HITS GABI_441A06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-17 LOCN Intron COOR W/28558-28610 NOTE - - HITS GABI_418A01 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 3e-12 LOCN Intron COOR W/28572-28610 NOTE - - HITS GABI_428C04 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 4e-06 LOCN Intron COOR W/28572-28595 NOTE - - HITS GABI_434D03 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-13 LOCN Intron COOR W/28572-28610 NOTE - - HITS GABI_434C06 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-09 LOCN Intron COOR W/28580-28610 NOTE - - HITS Wiscseq_DsLox329D04.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Intron COOR C/28822-28822 NOTE KG799046 Wisc 10K 1:28800 AACCTTTGATTAAAGGACGTGGTGTTTCGTATTGCAAGAACCTTCTTTCTCCTCGGTTTGAACAGTCAGGTTATAAGAAATTCTTTGTGGTGTAAACAAA HITS WiscDsLoxHs010_08B [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN Exon COOR C/29107-29846 HITS SALKseq_39202.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/29372-29372 NOTE KO440797 Salk 40K 1:29371 CCGGAGGCACACCAGGAGCAGACCACCTAGACGGGGCGAATCGATCCGCCCGGATATATTGTGGTGTAAACAAATTGA HITS GABI_243G10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 2e-34 LOCN Exon COOR C/29400-29488 NOTE - - HITS SALKseq_058498.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR W/29559-29559 NOTE KO392428 Salk 40K 1:29557 CAATCAAAGCCTCAACAACATCAGCTAACGTTTTGCTAGATAAAACTCGGTACGAACTTAATATTGTGGTGTAAACAA HITS GABI_786F05 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN Exon COOR C/29579-29921 NOTE at1g01040 CS475425 HITS GABI_111F10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL e-133 LOCN Exon COOR C/29579-29825 NOTE - - HITS FLAG_033C10 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN Exon COOR C/29796-30426 HITS Wiscseq_DsLoxHs010_08B.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/29819-29819 NOTE KG810620 Wisc 20K 1:29828 GTGTGCTCAAGAGCATCGACTTTGTTGGTCTTGAGAGAGCTCTTAAATATGAGTTTAAAGAGAAAGGTCTTCTTGTTGAA HITS WiscDsLox233237_06P [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN Exon COOR C/29858-30410 HITS GABI_111F10 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 0.0 LOCN Exon COOR W/29863-30358 NOTE - - HITS SAIL_226_H11 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 5e-93 LOCN Exon COOR C/29864-30064 HITS SAIL_1293_D08 [Seq] [About SAIL] [Order from ABRC] [Order from NASC] TYPE SAIL FST EVAL 1e-56 LOCN Exon COOR C/29865-29976 HITS GABI_448D12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 1e-74 LOCN Exon COOR C/30058-30250 NOTE - - HITS SK26421 [Seq] [About SK collection] [Vector pSKI015] [Order from ABRC] TYPE SK FST EVAL 3e-80 LOCN Exon COOR C/30072-30502 NOTE CS1008272 HITS WiscDsLoxHs135_06B [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN Exon COOR C/30097-30992 HITS WiscDsLoxHs135_05D [Seq] [Wisc & Vector] [Order from ABRC] TYPE Wisc FST EVAL 0.0 LOCN Exon COOR C/30103-30910 HITS SALKseq_101788.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/30209-30209 NOTE KO436263 Salk 10K 1:30147 TGTGAAGGAGGTTCAAACCGAGTCATCGAAACCGGGGTTTAACTCTTTTGGTGTAAACAAATTGACGCTTAGACAACTT HITS GABI_448D12 [Seq] [GABI-Kat] [SimpleSearch] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat FST EVAL 9e-07 LOCN Intron COOR W/30409-30468 NOTE - - HITS Wiscseq_DsLox233237_06P.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/30410-30410 NOTE KG795929 Wisc 10K 1:30388 GTTATTTCGGTTGAAAATCTCTAACTAACTCGTTTTTTTTTGGAATTGTAATTCTTAGCTTACTAAATCGTATGATTCTTTTCCAGGATATATTGTGGTG HITS SAILseq_356_F12.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/30727-30727 NOTE KO332401 SAIL 30K 1:30726 CACTTGCAGCTTTGAAAGAGAAAGAAATAGCAGAATCAAAGGAGAAGCATATCAACAACGGTAATGCGGGAGAGGATCAAGGCGAGAATGAGAAT HITS FLAG_007A02 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-127 LOCN Intron COOR W/30831-31060 HITS FLAG_023E06 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-107 LOCN Intron COOR W/30831-31025 HITS FLAG_026G03 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL 0.0 LOCN Intron COOR W/30831-31224 HITS FLAG_120A11 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-125 LOCN Intron COOR W/30831-31060 HITS FLAG_126C03 [Seq] [About INRA/FLAG FST] [FLAGdb] [Publication] [pGKB5 Vector] [Order from INRA] TYPE FLAG FST EVAL e-127 LOCN Intron COOR W/30831-31060 HITS Wiscseq_DsLoxHs135_06B.0 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/30974-30974 NOTE KG815614 Wisc 30K 1:30972 ATTTCGGGTTTGTGGTGAATTTTGTAGATGTGTGAAAGAAGGAGGACCGGCTCATGCAAAGAGATTTACGTTTGGGGTAAGAGTTAATACGAGCGATAGA HITS GABI_098F10 [Seq] [GABI-Kat] [SimpleSearch] [Confirmation] [pAC106] [pAC161] [pGABI1] [pADIS1] [Order from GABI-Kat] [Order from NASC] [Order from ABRC] TYPE GABI-Kat Confirmed EVAL 0.0 LOCN Exon COOR W/30997-31360 NOTE at1g01040 CS409382 HITS SALKseq_128845.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN Exon COOR C/31028-31028 NOTE KO387126 Salk 70K 1:30884 GGCGAGCCAATGCCGAGTGTTAAGAAAGCTAAGACAACAGAAATATCAGCACATTGCGCAAACAAATTGACGCTTAGA HITS RAFL08-11-E15 [NCBI] [Order from RIKEN BRC] TYPE RIKEN FL cDNA EVAL 98.82 LOCN 300-UTR3 COOR C/31183-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33114 HITS R13796 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 100.00 LOCN 300-UTR3 COOR C/31186-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33114 NOTE AY052717 HITS RAFL06-74-O18 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-108 LOCN 300-UTR3 COOR C/31188-31424,31521-31602,31693-31776 HITS AY085015 [GenBank] TYPE Community cDNA EVAL 99.90 LOCN 300-UTR3 COOR C/31188-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33148 HITS R14690 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.78 LOCN 300-UTR3 COOR C/31195-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33117 NOTE AY057668 HITS RAFL09-46-O10 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-122 LOCN 300-UTR3 COOR C/31197-31424,31521-31602,31693-31776 HITS RAFL05-14-F05 [NCBI] [Order from RIKEN BRC] TYPE RIKEN EST EVAL e-114 LOCN 300-UTR3 COOR C/31209-31424,31521-31602,31693-31815,31935-31997,32087-32197,32284-32348,32432-32460 HITS R16094 [SSP] [About & Citation] [NCBI] [Order] - click RAFL TYPE SSP cDNA EVAL 99.78 LOCN 300-UTR3 COOR C/31209-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670,33029-33118 NOTE AY065201 HITS U16094 [SSP] [About & Citation] [NCBI] [Order from ABRC] TYPE SSP Gateway Clone EVAL 100.00 LOCN 300-UTR3 COOR C/31216-31424,31521-31602,31693-31813,31933-31998,32088-32195,32282-32347,32431-32459,32547-32670 NOTE U16094 AY081555 pENTR-TOPO HITS BX841824 [GenBank] [Order] TYPE GSLT cDNA EVAL 3e-63 LOCN 300-UTR3 COOR C/31285-31424,31521-31602,31693-31815,31935-31997,32087-32197,32284-32348,32432-32458,32546-32672,33032-33107 HITS SALKseq_107475.2 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/31364-31364 NOTE KO436371 Salk 20K 1:31363 CTCCACACCCTGAGGCGTTGAAGCTTCTCCTCAGAAGATCATGACACATTAATAACACAAATTGACGCTTAGACAACTT HITS SALKseq_056251.1 T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG EVAL 0 LOCN 300-UTR3 COOR W/31375-31375 NOTE KO368871 Salk 30K 1:31373 ACTCTGGATTCTGAATTCCCCATTACAGGGACCTCTATGCTGAATACATTCTCCACACCCTGAGGCGTTGAAGCTTCT