CLON Wiscseq_DsLoxHs090_02B.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR W/19841163-19841163 NOTE KO453542 Wisc 20K 1:19841212 GAGGAATTTCTGAAGTGATGTTTTGGTTCTTTTACTCAACTGTAGGATTAAGGCCCTAATGATGGAGAAATTTCATCGTA HITS AT1G53200.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53200.1 CDS ID=AT1G53200.1; Parent=AT1G53200; Name=AT1G53200.1; Note=TAF RNA polymerase I subunit A; conf_class=2; computational_description=unknown protein%3B Has 21 Blast hits to 21 proteins in 9 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 0%3B Fungi - 0%3B Plants - 19%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:20226671, locus:2009570; locus_type=protein_coding LOCN Exon COOR C/19840486-19840970,19841067-19841197,19841312-19841397,19841526-19841689,19841780-19842213,19842435-19842517,19842634-19842741,19842819-19843169 HITS AT1G53200.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53200.2 CDS ID=AT1G53200.2; Parent=AT1G53200; Name=AT1G53200.2; Note=TAF RNA polymerase I subunit A; conf_class=3; computational_description=unknown protein%3B Has 21 Blast hits to 21 proteins in 9 species: Archae - 0%3B Bacteria - 2%3B Metazoa - 0%3B Fungi - 0%3B Plants - 19%3B Viruses - 0%3B Other Eukaryotes - 0 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:20226671, locus:2009570; locus_type=protein_coding LOCN Exon COOR C/19840486-19840970,19841067-19841197,19841312-19841397,19841526-19841689,19841780-19842213,19842435-19842517,19842651-19842692