CLON Wiscseq_DsLoxHs051_12F.1  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/76713-76713 NOTE KG812593 Wisc 20K 1:76713 ATATTTTTTTTCCATCTTTTGAAAATTAATGGATTTGAGGTTTTTGATTGTGTAATGAGAAAAAATATTTGATTGATCAG HITS AT1G01180.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G01180.1 CDS ID=AT1G01180.1; Parent=AT1G01180; Name=AT1G01180.1; Note=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; conf_class=1; computational_description=S-adenosyl-L-methionine-dependent methyltransferases superfamily protein%3B FUNCTIONS IN: methyltransferase activity%3B INVOLVED IN: lipid biosynthetic process%3B EXPRESSED IN: sperm cell%2C hypocotyl%3B CONTAINS InterPro DOMAIN/s: Rhamnosyl O-methyltransferase/Cephalosporin hydroxylase (InterPro:IPR007072)%3B Has 274 Blast hits to 274 proteins in 51 species: Archae - 0%3B Bacteria - 75%3B Metazoa - 2%3B Fungi - 0%3B Plants - 46%3B Viruses - 0%3B Other Eukaryotes - 151 (source: NCBI BLink).; conf_rating=*****; Dbxref=PMID:12101121, PMID:15703057, PMID:16520461, locus:2035262; locus_type=protein_coding LOCN 300-UTR3 COOR W/75633-76556 HITS AT1TE00220[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1TE00220 transposable_element ID=AT1TE00220; Name=AT1TE00220; Alias=TA11 LOCN 300-UTR5 COOR W/76844-77500 HITS AT1G08765.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G08765.1 transcript_region ID=AT1G08765.1; Parent=AT1G08765; computational_description=novel transcribed region; Name=AT1G08765.1; locus_type=novel_transcribed_region LOCN 1000-Promotor COOR W/77537-80345