CLON Wiscseq_DsLox441C3.0  T-DNA NextG Sequences by Salk Institute for SALK, SAIL, GABI(GK) and Wisc lines.
By comparison with old FSTs, The NG sequences are mapped on the reverse complimentary strand.
We change the mapping direction to its reverse strand for the isect primer design purpose.
[GenBank] [iSect Primer] [ORDER ABRC => TAIR Polymorphism/Allele Search] [T-DNA Seq Next Generation sequencing evidences by Salk] TYPE T-DNA Seq NextG CHRO chr1 EVAL 0 COOR C/19851175-19851175 NOTE KG805203 Wisc 10K 1:19851153 AAGGAGGAAGCTGAGCAAGATCATCAATGGCGGATTTAGCTTTAGTAATAAGCCAATCAACAGCTTTACTTGGTCGAAACAAATTATGGTGTAAACAAAT HITS AT1G53233.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53233.1 antisense_lncRNA ID=AT1G53233.1; Parent=AT1G53233; curator_summary=Potential natural antisense gene%2C locus overlaps with AT1G53230; Dbxref=locus:4010713544; Name=AT1G53233.1; description=Natural antisense transcript overlaps with AT1G53230; Note=Natural antisense transcript overlaps with AT1G53230; locus_type=antisense_long_noncoding_rna LOCN Exon COOR W/19850201-19852127 HITS AT1G53230.1[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53230.1 CDS ID=AT1G53230.1; Parent=AT1G53230; Name=AT1G53230.1; Note=TEOSINTE BRANCHED 1%2C cycloidea and PCF transcription factor 3; curator_summary=Encodes a member of a recently identified plant transcription factor family that includes Teosinte branched 1%2C Cycloidea 1%2C and proliferating cell nuclear antigen (PCNA) factors%2C PCF1 and 2. Regulated by miR319. Involved in heterochronic regulation of leaf differentiation.; conf_class=2; symbol=TCP3; full_name=TEOSINTE BRANCHED 1%2C cycloidea and PCF transcription factor 3; computational_description=TEOSINTE BRANCHED 1%2C cycloidea and PCF transcription factor 3 (TCP3)%3B CONTAINS InterPro DOMAIN/s: Transcription factor%2C TCP (InterPro:IPR005333)%2C Transcription factor TCP subgroup (InterPro:IPR017887)%3B BEST Arabidopsis thaliana protein match is: TCP family transcription factor 4 (TAIR:AT3G15030.3)%3B Has 1510 Blast hits to 1508 proteins in 333 species: Archae - 0%3B Bacteria - 12%3B Metazoa - 43%3B Fungi - 12%3B Plants - 1439%3B Viruses - 2%3B Other Eukaryotes - 2 (source: NCBI BLink).; conf_rating=****; Dbxref=PMID:10363373, PMID:11118137, PMID:11371624, PMID:10490023, PMID:16169896, PMID:16813578, PMID:17189327, PMID:17217541, PMID:17307931, PMID:18424613, PMID:18805992, PMID:20007771, PMID:21119060, PMID:21183706, PMID:21610018, PMID:24118612, PMID:25625546, locus:2009595; locus_type=protein_coding LOCN Exon COOR C/19850260-19851435 HITS AT1G53230.2[Seq] [Transcriptome] [RiceGE] [SNP Search] [gAtlas] [GO] [NCBI] [NCBI Map] [TAIR] [MPSS] [AMPDB/SUBA] [KEGG]
[Protein Interaction] [TIGR] [AtGene Express] [AtGDB View] [e-FP Browser] [YE Clone] [AthaMap] [Phosphat] [Methylome]
[Genevestigator] [UToronto BAR Expression Angler] [Araport ] TYPE Gene TITL AT1G53230.2 CDS ID=AT1G53230.2; Parent=AT1G53230; Name=AT1G53230.2; Note=TEOSINTE BRANCHED 1%2C cycloidea and PCF transcription factor 3; symbol=TCP3; full_name=TEOSINTE BRANCHED 1%2C cycloidea and PCF transcription factor 3; Dbxref=PMID:10363373, PMID:11118137, PMID:11371624, PMID:10490023, PMID:16169896, PMID:16813578, PMID:17189327, PMID:17217541, PMID:17307931, PMID:18424613, PMID:18805992, PMID:20007771, PMID:21119060, PMID:21183706, PMID:21610018, PMID:24118612, PMID:25625546, locus:2009595; curator_summary=Encodes a member of a recently identified plant transcription factor family that includes Teosinte branched 1%2C Cycloidea 1%2C and proliferating cell nuclear antigen (PCNA) factors%2C PCF1 and 2. Regulated by miR319. Involved in heterochronic regulation of leaf differentiation.; computational_description=TEOSINTE BRANCHED 1%2C cycloidea and PCF transcription factor 3 (TCP3)%3B CONTAINS InterPro DOMAIN/s: Transcription factor%2C TCP (InterPro:IPR005333)%2C Transcription factor TCP subgroup (InterPro:IPR017887)%3B BEST Arabidopsis thaliana protein match is: TCP family transcription factor 4 (TAIR:AT3G15030.3)%3B Has 1510 Blast hits to 1508 proteins in 333 species: Archae - 0%3B Bacteria - 12%3B Metazoa - 43%3B Fungi - 12%3B Plants - 1439%3B Viruses - 2%3B Other Eukaryotes - 2 (source: NCBI BLink).; locus_type=protein_coding LOCN Exon COOR C/19850260-19851435